We narrowed to 24,121 results for: CRISPR
-
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC149-pCR8-dCas9VP160
Plasmid#48221PurposedCas9VP160 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain
UseCRISPR; Gateway donorTagsHA Tag and VP160MutationD10A;H840A nuclease-deficientAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDicAID_nCas9-PmCDA-2A-NptII_ETR
Plasmid#91695PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1-2A-NptII with sgRNA targeting SlEtrDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette)
Plasmid#100716PurposeB52 plasmid expressing ATP1A1 sgSTOP (cloned in BsmBI site) and containing an empty sgRNA-expression cassette (use BbsI for cloning)DepositorInsertsgSTOP targeting ATP1A1 (cloned using BsmBI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145694)
Plasmid#80191Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRDB_181
Plasmid#216102PurposeCRISPRi, EF1a-driven dCas9-KRAB (ZNF10) (Cas only)DepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGAL4-1
Plasmid#46915PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoterDepositorInsertssgGAL4-1
Puromycin resistance and mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP
Plasmid#171090PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus thermophilus (CRISPR1 locus) in Toxoplasma gondii. Suitable for generating stable cell lines.DepositorInsertsSth1 dCas9
Chloramphenicol acetyltransferase
TagBFP
UseCRISPR; Toxoplasma gondii expressionTags3xFLAG, P2A peptide, SV40 NLS, T2A peptide, and n…MutationD9A, H599APromoterTUB1 (Toxoplasma gondii), transcriptionally linke…Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001149263)
Plasmid#76843Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001149268)
Plasmid#77541Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAC95-pmax-dCas9VP160-2A-neo
Plasmid#48227PurposedCas9VP160-2A-neo (neo/G418-selectable) on pmax expression vector. Note: This is being tested.DepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
UseCRISPRTags2A-neo, HA Tag, and VP160ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP302-pAAV-CMV-dSaCas9-KRAB-pA
Plasmid#113677PurposeA CMV driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001147319)
Plasmid#75914Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148500)
Plasmid#80260Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMonAID_dCas9-PmCDA_Hyg_ALS
Plasmid#91692PurposeMonocot Target-AID vector expressing rice-optimized dCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A and H840A for dead Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(S)Cas9
Plasmid#127383PurposeExpresses Cas9 at high levelDepositorInsertuORF(S)-Cas9
UseCRISPRExpressionInsectPromoterUASTAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146145)
Plasmid#80198Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only