We narrowed to 11,070 results for: AGA
-
Plasmid#216807PurposeshRNA against rat Sirt3DepositorAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pYSD101
Plasmid#212925PurposeEncodes the S. cerevisiae SUC2 (Invertase) protein (Part3b') with the Aga2 signal peptide (Part3a') assembled with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSUC2 (SUC2 Budding Yeast)
ExpressionYeastAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-35_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211679PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-35 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-31_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211675PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-31 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Merry-eCMV-SaSpD10A+linker (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210736PurposeCoding for SaSp D10A Cas9 alongside Merry sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Merry sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-32_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211676PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-32 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgRPA1-1_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211658PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgRPA1-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mYwhae -2
Plasmid#198498Purposelentiviral stable expression of mYwhae gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS1
Plasmid#174301PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA
Plasmid#194725Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA array targeting both AAVS1 and MAFBDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB1839
Plasmid#193103PurposeGB-cassette for the expression of guide RNA targeting the DFR promoter in -376 position (gRNA2), with 2.1 Ms2 aptamer in the 3' of the scaffold.DepositorInsertGB_SynP gRNA2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.108
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.109
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.107
Plasmid#184976PurposeTest effect of extending a1/a2 on CAN1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 27 v1
ExpressionYeastMutationCAN1 donor G444stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.106
Plasmid#184975PurposeExpress -Eco1 CAN1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 12
ExpressionYeastMutationCAN1 donor G444stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW402-lenti-sg2-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189951PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg2-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
TagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC030.306
Plasmid#171151PurposeMevalonate production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mvaES
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-mSNX27-H112A RNAi-resistant
Plasmid#163621Purposemouse SNX27 cDNA with point mutation to resist siRNA against SNX27 and with a point mutation H112A C-terminally tagged with GFPDepositorInsertmouse SNX27-H112A RNAi-resistant (Snx27 Mouse)
TagsGFPExpressionMammalianMutationH112A and RNAi resistanceAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_Psyn-sgRNAmreB
Plasmid#149595Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
ExpressionBacterialPromoterPflaB, PpQE30(-10TC), PsynAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide#2
Plasmid#121994PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PnGW
Plasmid#133355PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications), co-expressed with GFP-NLSDepositorInsertGFP-NLS
TagsHA-tagged GFPExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.PARN-2
Plasmid#128760PurposeExpresses PARN gRNA for CRISPRiDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-3
Plasmid#128758PurposeExpresses PAPD4 gRNA for CRISPRiDepositorAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-1
Plasmid#128756PurposeExpresses PAPD4 gRNA for CRISPRiDepositorAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
gamma2 CR3m shRNA
Plasmid#120795PurposeNegative control shRNA for plasmid 120794: shRNA targeting the coding region of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR3m shRNA
Plasmid#120797PurposeNegative control shRNA for plasmid 120796: shRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SUV39h2 ts1
Plasmid#115883PurposeSUV39h2 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only