We narrowed to 1,064 results for: Superfolder GFP
-
Plasmid#199171Purposeused to express a superfolder GFP in E. coli for comparison to supercharged variantsDepositorInsertsuperfolder GFP
TagsMGHHHHHHGGAPromoterT7Available SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-24xGCN4_v4-sfGFP
Plasmid#61058PurposeA direct fusion of sfGFP to the 24xGCN4_v4 peptide arrayDepositorInsert24xGCN4_v4 peptide array and sfGFP
ExpressionMammalianAvailable SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
BAS286 C terminal SF-GFP hygBR
Plasmid#74081PurposeS.pombe recoded superfolder GFP in universal C-terminal tagging plasmid, hygB resistancDepositorInsertsuper-folder GFP
Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRT7 NT Topo tetR/pLtetO Amp‐WT sfGFP
Plasmid#52053PurposeUsed in phosphoprotein synthesis. Replace the sfGFP with gene of interest (GOI). Add TAG amber codon(s) at the position(s) in GOI where phosphoserine incorporation is desired.DepositorInsertsfGFP
ExpressionBacterialPromotertetR/pLtetOAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP-134/150TAG
Plasmid#174077PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP-134/150TAG with C-terminal His6 tag, under T7 promoterDepositorInsertSuperfolder GFP
TagsHis-6ExpressionBacterialMutationD134TAG + N150TAGPromoterT7Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1
Plasmid#69496PurposepJL1 expression vector with sfGFPDepositorInsertSuper folder GFP
ExpressionBacterialPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac2.0
Plasmid#119872PurposeCumate-inducible expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR
sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPveg promoter with CuO sequence and PxylR promoterAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac1.8
Plasmid#119871PurposeConstitutive expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR'
sfGFP
UseSynthetic BiologyExpressionBacterialMutationSNP in 592 bpPromoterPserA promoter and Pveg promoter with CuO sequenceAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR59.4
Plasmid#63175PurposeExpresses OmpR constitutively from PompB97 and sfGFP under the PompF146 promoterDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
4xHRE_YB TATA-sfGFP-CMV_dsRed
Plasmid#117399PurposesfGFP expressed from hypoxia-inducible YB_TATA promoter and dsRed expressed from consitutive CMV promoterDepositorInsertSuperFolder GFP
ExpressionMammalianAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pM1s3AsG
Plasmid#137921PurposeE. coli Nissle pMUT1-derived plasmid with ampicillin resistance and constitutive GFP expressionDepositorInsertSuperfolder GFP
UseSynthetic Biology; For use with e. coli nissle in…ExpressionBacterialPromoterJ23101Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpyCatcher003-sfGFP
Plasmid#133449PurposeExpresses SpyCatcher003-superfolder GFP in bacterial cytoplasmDepositorInsertSpyCatcher003-sfGFP
TagsHis6 and TEV siteExpressionBacterialPromoterT5Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPM_Pveg-sfgfp
Plasmid#121503PurposeIntegration vector that expresses gfp in S. mutansDepositorInsertSuperfolder GFP
UseS. mutans integration vector, integrates at the m…PromoterPvegAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpyTag003-sfGFP
Plasmid#133454PurposeExpresses SpyTag003-superfolder GFP in bacterial cytoplasmDepositorInsertSpyTag003-sfGFP
TagsGSGSGS linker and His6ExpressionBacterialPromoterT7Available SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDA313
Plasmid#195214PurposeExpression of superfolder GFP (sfGFP) by a hybrid T7 promoter with tetO.DepositorInsertsfGFP with tetO and a hairpin
ExpressionBacterialPromoterT7Available SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWKS12
Plasmid#139419PurposeFluoroescent marker for use in Cryptococcus neoformans. Contains a codon optimised Superfolder GFP marker.DepositorInsertSuperfolder GFP
ExpressionYeastPromoterTEF1Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP35
Plasmid#247210PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJT119b
Plasmid#50551PurposeExpresses CcaS and CcaR constitutively, and sfGFP under the PcpcG2 promoterDepositorInsertsCcaS
CcaR
sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only