167,150 results
-
Plasmid#118963PurposeIntermediate/cloning vector that can be used for sub-cloning into final destination vectors based on one's requirements.DepositorInsertCas13a
ExpressionPlantAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_EGFP
Plasmid#183117PurposeExpresses flag-tagged EGFP in mammalian cellsDepositorInsertEGFP
UseLentiviralTagsFlagExpressionMammalianPromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
NeonGreen-C1-ORP5
Plasmid#220071Purposeoverexpresses ORP5 with a neonGreen fluorophoreDepositorInsertOSBPL5 (OSBPL5 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5ā-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETNb-nALFA
Plasmid#159988PurposeFor the protein expression with ALFA tag at N-terminus in E. coliDepositorTypeEmpty backboneTagsMVKYI-8histidine-ALFA tag-HRV3C protease cleavageā¦ExpressionBacterialAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-2xCLEAR-luciferase
Plasmid#81120PurposeReporter activity of the CLEAR networkDepositorInsert2xCLEAR
UseLuciferaseTagsluciferasePromoter2xCLEARAvailable SinceDec. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-MYC-IRES-luc
Plasmid#129775PurposeTransposon based vector that expresses human MYC followed by IRES and firefly luciferaseDepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PKD1-F (pCI-PKD1-Flag)
Plasmid#21369DepositorInsertautosomal dominant polycystic kidney disease type I (PKD1 Human)
TagsFLAGExpressionMammalianMutationwild-type sequence*Available SinceJan. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHD-DsRed
Plasmid#51434PurposeVector for generating dsDNA donors for homology-directed repair. Contains the visible marker 3xP3-DsRed.DepositorInsertLoxP-3xP3-DsRed-LoxP
Promoter3xP3Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW empty vector
Plasmid#184708PurposeLentiviral empty vector for doxycycline-inducible expressionDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutatiā¦Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ClpX
Plasmid#234733PurposeHuman-codon optimized E. coli ClpX in mammalian cellsDepositorInsertClpX
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Centrin2-N-10
Plasmid#55018PurposeLocalization: Centrosomes, Excitation: 587, Emission: 610DepositorAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-LACTB-dAPEX2
Plasmid#117180PurposePlasmid name in publication: pAAV-DIO-IMS-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertLACTB-dAPEX2
UseAAV and Cre/LoxExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Orai1 YFP
Plasmid#19756DepositorAvailable SinceOct. 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTUB1:YFP-mAID-3HA, DHFR-TS:HXGPRT
Plasmid#87259PurposeYFP-mAID-3HA fusion driven by a minimal TUB1 promoter with an HXGdrug selectable marker. The mAID CDS is from Arabidopsis thaliana auxin-responsive protein IAA17E66-S133DepositorInsertsYFP-mAID-3HA
HXGPRT
UseToxoplasma expressionTags3HA and mAIDMutationCodon optimized for Toxoplasma gondii expressionPromoterTgDHFR-TS 463 bp and TgTUB1 378 bpAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCN DSB Repair Reporter (DRR)
Plasmid#98895PurposeDSB Repair Reporter (DRR). Expresses GFP after cut of two inverted ISce1 sites and repair by NHEJ.DepositorInsertNeomycin-T2A-ISce1-ISce1-eGFP
UseLentiviralPromoterCMVAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
GSK3 beta pGEX
Plasmid#15898DepositorAvailable SinceNov. 1, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFP-GRAM-W
Plasmid#211701PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187W mutation (EGFP-GRAM1b G187W) in mammalian cellsDepositorInsertGRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
TagsEGFPExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only