We narrowed to 19,151 results for: Tat
-
Plasmid#24373DepositorInsertCLASP2 (340-1362) 9xS/A (CLASP2 Human)
TagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBabe-TetCMV-puro-mCerulean-PA-Rac1
Plasmid#22031DepositorInsertmCerulean-PA-Rac1 (RAC1 Avena sativa (oat), Human)
UseRetroviralExpressionMammalianMutationRac1 starts at I4 and contains mutations Q61L, E9…Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGH045_EGFP
Plasmid#85411Purposelentiviral expression vector for GFPDepositorInsertEGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-UnaG
Plasmid#203485PurposeFor recombinant protein production in Escherichia coli. His-tagged UnaG under the control of the T7 promoter.DepositorInsertUnaG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT870 human L1 RT- (ORF2p D702Y) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213027PurposeExpresses reverse transcriptase dead (RT- ORF2p D702Y) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, RT- D702Y) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationD702Y (RT- reverse transcriptase catalytic dead)PromoterCMVAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUASp YFP Rac1 DN
Plasmid#52234PurposeDrosophila expression of YFP-Rac1 dominant negative mutantDepositorInsertRac1 (Rac1 Fly)
UseDrosophilaTagsYFPExpressionInsectMutationT17N; DN mutationPromoterGAL4Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH2B-miRFP720-N1
Plasmid#197231PurposeExpresses the fusion protein of H2B-miRFP720 in mammalian cellsDepositorInsertH2B-miRFP720
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-E2-Crimson
Plasmid#197196PurposeExpresses the protein of E2-Crimson in mammalian cellsDepositorInsertE2-Crimson
UseAAVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC10
Plasmid#104784PurposepAH595-gRNA 2xplex entry cassetteDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC5
Plasmid#104779PurposepSC218GG-Glycine max Ubiquitin:Gateway expression cassette binary vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICSL50015
Plasmid#50318PurposePlease note- this plasmid is currently not distributed in the MoClo Plant Parts Kit (# 1000000047)DepositorInsertCDS, mNEON (Branchistoma lanceolatum)
UsePlant expressionMutationBsaI/BbsI sites removed by point-mutationAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL30009
Plasmid#50301DepositorInsertN terminal Myc tag (4x Myc)
UsePlant expressionMutationBsaI/BbsI sites removed by point-mutationAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLIGFP_W220F
Plasmid#46772PurposeProtein overexpression with the modified LacIWF repressorDepositorInsertLacI_W220F (lacI )
MutationTryptophan 220 replaced by PhenylalanineAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAPA3
Plasmid#24777DepositorTypeEmpty backboneUseIntegrating vectorExpressionBacterialAvailable SinceAug. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PYGL_WT_V5
Plasmid#82991PurposeGateway Donor vector containing PYGL, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_DOK1_WT
Plasmid#82884PurposeGateway Donor vector containing DOK1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNR64
Plasmid#79540PurposeInput plasmid: expresses two recombinases downstream of two inducible promoters. Same as Dual-Recombinase-Controller (plasmid #44456) from Endy Lab except with KanR instead of CamR on the backbone.DepositorInsertsTP901
BxbI
TagsHis tag and LAA degradation tagExpressionBacterialAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only