We narrowed to 7,491 results for: RAP
-
Plasmid#184656PurposeRetroviral expression of mouse EPC1 delta EPcCDepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1 delta EPCc.QTPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c028
Plasmid#175470PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains H288A point mutation that reduces binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c021
Plasmid#175468PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R point mutation that reduces binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
S2 1058 APOBEC3 no UGI
Plasmid#135350PurposeExpression of intradomain insertion of rat cytosine deaminase, rAPOBEC3, at position 1058 of nSpyCas9 lacking uracil DNA glycosylase inhibitor.DepositorInsertnSpyCas9-rAPOBEC3-ID-1058
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 WT
Plasmid#129292PurposeGateway entry clone encoding wild-type human ATG3 with a stop codonDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 K243R
Plasmid#129294PurposeGateway entry clone encoding human ATG3 K243RDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged Lysine 243 to ArginineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 LC3B G120A no-stop
Plasmid#123206PurposeGateway entry clone encoding human MAP1LC3B G120A lacking stop codon, suitable for C-terminal taggingDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseGateway entry vector / entry cloneMutationGlycine 120 to Alanine, stop codon removedAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTYB-pLAC-L108S/L109S/F112S
Plasmid#48730PurposeBacterial expression of Lacritin Protein with Mutation at proteins 108 and 109 Leucine to Serine and 112 from phenylalanine to serineDepositorInsertLacritin (LACRT Human)
TagsInteinExpressionBacterialMutationLeucine 108 and 109 to Serine; phenylalanine 112 …PromoterT7Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG PSAM4-5HT3 HC IRES EGFP
Plasmid#119740PurposeChemogenetic activator expression plasmidDepositorExpressionMammalianMutationL131G, Q139L, Y217F, R420Q, R424D, R428APromoterCAGAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIG-601_NY-ESO-1_TCR_GFP
Plasmid#207482PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertGFP, NY-ESO-1_TCR
UseCRISPRMutationPotential silent point mutation in GFP sequenceAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-p21
Plasmid#171122PurposeDoxycycline inducible expression of p21DepositorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-5'Luciferase(split CAGGT)_BDlacZ-SV40polyA
Plasmid#216320PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA
Plasmid#216321PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-ScAct1*-thymosinB-8His
Plasmid#111148PurposeExpresses Saccharomyces cerevisiae Act1 (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag. TH3-37DepositorInsertAct1 (ACT1 Budding Yeast)
UsePichia pastoris integration plasmidTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKMW123_SpRY-Cas9_U6-entry
Plasmid#244820PurposeMammalian expression of SpRY Cas9 with Golden Gate-compatible sgRNA spacer cassetteDepositorInsertSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterCAG, U6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA
Plasmid#216318PurposeSplit fluorophore assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertsplit cerulean fluorescent protein + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY093-EFS-BCMA-Blast-WPRE
Plasmid#192194PurposeLenti-BCMA-OE-BlastDepositorAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Bst LF-6xHis
Plasmid#159148Purposeexpresses His-tagged large fragment of Bst polymeraseDepositorInsertlarge fragment of Geobacillus stearothermophilus DNA polymerase I
TagsHisExpressionBacterialAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_haPD-1
Plasmid#226716PurposePlasmid enabling yeast-mediated expression and secretion of high affinity PD-1 microbody (haPD-1)DepositorInsertHigh affinity PD-1 microbody
TagsHA tag and Mating factor alpha secretion signalExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-YAP
Plasmid#166457PurposeExpresses fusion of mEGFP and YAPDepositorInsertmEGFP, YAP (YAP1 Human)
ExpressionMammalianAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shSTING-Hsa
Plasmid#128158PurposeDoxycyclin inducible shRNA knockdown of human STING geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiMPH v2 (Neo)
Plasmid#92065PurposeModified version of lentiMPH v2, a lenti vector encoding the MS2-P65-HSF1 activator helper complex and neo resistance marker (EF1a-MS2-p65-HSF1-2A-Neo-WPRE).DepositorInsertMS2-P65-HSF1_2A_Neo (HSF1 Human, Synthetic)
UseLentiviralExpressionMammalianMutationN55K in MS2PromoterEF1aAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only