We narrowed to 6,763 results for: poly
-
Plasmid#162586PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlycine 131 changed to Cysteine and Asparagine 17…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N167C-L169C
Plasmid#162587PurposeExpresses norovirus GI.1 VP1 protein with mutations N167C-L169C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 167 changed to Cysteine and Leucine 16…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-ADAP1
Plasmid#163906PurposeFull length mouse ADAP1 with N terminal fluorescent tag for purification from insect cellsDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
Plasmid#79030PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
TagsOneSTrEP-FLAGExpressionInsectMutationdeleted amino acid 294-515 from frican green monk…PromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-hCD155
Plasmid#118630Purposehuman CD155 coding sequence subcloned into pMP71 retroviral plasmidDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-ApoE4
Plasmid#87087PurposeExpresses ApoE4 in Mammalian cellsDepositorAvailable SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-ApoE3
Plasmid#87086PurposeExpresses ApoE3 in Mammalian cellsDepositorAvailable SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-ApoE2
Plasmid#87085PurposeExpresses ApoE2 in Mammalian cellsDepositorAvailable SinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSSRB070_pAC8-hsCRBN
Plasmid#218789PurposeInsect cell expression vector for FLAG-TEV-Spy-hsCRBNDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin G13R
Plasmid#60615PurposeEncodes YFP and NLS tagged beta-actin with the G13R depolymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
miABE
Plasmid#205412PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6-_RNA*-pCAG-bpNLS-TadA8e(V106W)-32aa-OgeuIscB*(D61A)-GS-bpNLS-GS-TadA8e(V106W)-bpNLS-bGH polyA-pCMV-mCherry-AmpR
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RBXN-P2A-BLAST
Plasmid#208048PurposeEnables constitutive expression of BirAopt alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; to perform bioE3; selection with blasticidinDepositorInsertBirAopt
UseLentiviralMutationBirAopt is human-codon-optimized BirA (PMID 15707…PromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET15b-His-3C-irisin
Plasmid#122612PurposeExpresses in E. coli: human irisin with Nt histag and 3C protease site for cleavageDepositorInsertirisin (ectodomain of FNDC5) (Fndc5 Mouse, Human, Rat, Bovine)
TagsNt: histag-3C protease siteExpressionBacterialPromoterT7 polymeraseAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin S14C
Plasmid#60614PurposeEncodes YFP and NLS tagged beta-actin with the S14C polymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-Flag-FANCD2
Plasmid#134904Purposecodon optimized expression and purification of human FANCD2 in insect cells using baculovirusDepositorInsertFANCD2 (FANCD2 Human)
TagsFlagExpressionInsectMutationfully synthetic, codon optimized for insect expre…PromoterpolyhedronAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF155/SMARCC1-His
Plasmid#177863PurposeTransfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-HisDepositorInsertSMARCC1 (SMARCC1 Human)
TagsHis and His tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
A3Ai-Cas9n-UGI-NLS
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Synthetic, Human)
TagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.JARID2
Plasmid#125166PurposeExpresses human JARID2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN2
Plasmid#188235PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OS
Plasmid#136576PurposeDox-inducible polycistronic lentiviral vector expressing mouse Oct4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac (GST-SNAP-Shp2)
Plasmid#177897PurposeBaculo expression of GST tag fused to SNAP tag and human Shp2DepositorInsertShp2 (PTPN11 Human)
TagsTEV-GST-PreScission cut site-SNAP tagExpressionInsectPromoterPolyhedrinAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8 H143A
Plasmid#224344PurposeExpresses human KDAC8 (HDAC8) H143A in insect cellsDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionInsectMutationHistidine 143 mutated to alaninePromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits