We narrowed to 2,388 results for: control GFP
-
Plasmid#170083PurposeGFP expression under the control of E. coli dnaK promoter engineered with double IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2-IR2Available SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-FF3
Plasmid#11662Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-FF3
Plasmid#11663Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with CMV promoter controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP-mirNega
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVPromoterCAGAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMGS36 (GFP-ARF16-PB1)
Plasmid#126581PurposeConstruct to express GFP-ARF16-PB1 under the control of the CMV promoterDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_VHH-GFP4::CD8::mCherry
Plasmid#163917PurposeExpression of a membrane-tethered GFP-nanobody marked by mCherry under control of the UAS or LOP enhancersDepositorInsertFusion of vhhGPF4 nanobody with mouse CD8 transmembrane protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9650-BEAR-GFP-preedited
Plasmid#162992PurposeBEAR control plasmid with split EGFP and intact 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-mito
Plasmid#229693PurposeTransient expression of EGFP AP4-mito in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (mitochondria)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TREX-GFP-FF3
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-cyto
Plasmid#229694PurposeTransient expression of EGFP AP4-cyto in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (cytoplasm)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S::SP-mCherry-GFP-HDEL
Plasmid#159097PurposePositive control for FRET in plant ER / nuclear envelope.DepositorInsertSP-mCherry-GFP-HDEL
TagsmCherry, GFPExpressionPlantPromoter35SAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_Hyg_FLAG-BirA-eGFP-NLS2
Plasmid#170917PurposeExpresses FLAG-BirA-eGFP-NLS2 to be used as control in BioID or FLAG pull downDepositorInsertFLAG-BirA-eGFP-NLS2
TagsBirA-FLAGExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-DsRed_IRES_EGFP
Plasmid#92194PurposeLentiviral overexpression vector to make stable bicistronic cell line for control (EGFP) screenDepositorInsertDsRed-IRES-EGFP
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX
Plasmid#181873PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoterDepositorInsertsUseAAV and AdenoviralTagsHA and mycExpressionMammalianPromotersynthetic hybrid CAG promoter and synthetic hybri…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX GFP-HA
Plasmid#229501PurposeControl HA-tagged protein for immunoprecipitation experiments.DepositorInserteGFP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP
Plasmid#166143PurposeEGFP expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-dt/deltaEGFP
Plasmid#163919PurposePGK-driven dTomato expression. Lacks the CBA-promoter controlling EGFP expression.DepositorInsertdtomato
UseLentiviralExpressionMammalianMutationWTAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk(R28C)-GFP
Plasmid#51464PurposeNon-PIP3 binding control for PH-Btk-GFPDepositorAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-mEGFP-dspB(E184Q W330Y)-6xHis
Plasmid#176575PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV UBC OSBP(PH)-APEX2-3xFLAG-IRES-eGFP
Plasmid#218637PurposeProximity biotinylation control of OSBP(PH domain)DepositorInsertOSBP (OSBP Human)
UseLentiviralTagsAPEX2-3xFLAGExpressionMammalianMutationPH domain onlyPromoterUBCAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
p415 TEF roGFP2‐Tsa2ΔCR
Plasmid#83238PurposeThe genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For cytosolic expression.DepositorInsertroGFP2-Tsa2dCr
TagsroGFP2 fusion with Tsa2dCrExpressionYeastPromoterTEFAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfralpha-EGFPN D842V
Plasmid#66789PurposeExpression of constitutively active murine PDGFRalpha D842V tagged with GFP under the control of EF1a promoterDepositorInsertPDGFRalpha (Pdgfra Mouse)
TagsEGFPExpressionMammalianMutationD842V (constitutively active)PromoterEF1aAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRE/VEGF/IRES/EGFP
Plasmid#206211PurposeAn expression vector of VEGF and EGFP under control of TRE promoterDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro GFP shRNA
Plasmid#10675PurposeNegative control vector for pMKO.1 puro (Addgene plasmid #8452); Contains shRNA against GFP.DepositorInsertGFP shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Prdm9CD-CatMut
Plasmid#235586PurposeDox-inducible expression of control catalytic-mutant Prdm9 CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eGFP-Cre
Plasmid#120219PurposeExpresses cre under the control of CamKIIa promotorDepositorInsertcre
UseAAV and Cre/LoxTagsEGFPAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p415 TEF roGFP2‐Tsa2ΔCPΔCR
Plasmid#83239PurposeThe catalytically inactive genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCPΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For cytosolic expression.DepositorInsertroGFP2-Tsa2dCpdCr
TagsroGFP2 fusion with Tsa2dCpdCrExpressionYeastPromoterTEFAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tet-myr-CSK-GFP
Plasmid#83470PurposeLentiviral vector for doxycycline-inducible expression of membrane targeted-CSK in mammalian cellsDepositorInsertCSK (CSK Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterdoxycycline-inducible promoterAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Kmt5cFL-CatMut
Plasmid#235590PurposeDox-inducible expression of control catalytic-mutant Kmt5c CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin
Plasmid#166603PurposeEncodes Cre-dependent eGFP-2A tetanus toxin light chain fragment under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP shRNA tet pLKO puro
Plasmid#163017PurposeControl tet-inducible shRNA targeting eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseLentiviralAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-EGFP-WPRE
Plasmid#187103PurposeDouble floxed EGFP under the control of EF1a promoterDepositorInsertEGFP
UseAAVPromoterEF1aAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
EW434 4x(ZNF35/ZNF35tar)-SFFV-GFP
Plasmid#236143PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF35 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF35 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW435 4x(ZNF35/IKZF1tar)-SFFV-GFP
Plasmid#236144PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/IKZF1 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/IKZF1 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW420 4x(ZNF35/ZNF250tarv3)-SFFV-GFP
Plasmid#236139PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF250 binding site…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-EGFP
Plasmid#84041Purpose3rd generation lentiviral transfer plasmid. Expresses EGFP and puromycin resistance in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertEnhanced Green Fluorescence Protein, Puromycin resistance gene
UseLentiviralExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfrbeta-EGFPN
Plasmid#66790PurposeExpression of murine PDGFRbeta tagged with GFP under the control of EF1a promoterDepositorAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID
Plasmid#240231PurposeExpression of sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertsfGFP-TurboID
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
1533_pAAV-CB-AcGFP-BirA-HA
Plasmid#208201PurposeControl for FKBP12-BirA constructDepositorTypeEmpty backboneUseAAVPromoterChicken beta actinAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Ezh2FL-CatMut
Plasmid#235584PurposeDox-inducible expression of control catalytic-mutant Ezh2 fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-SV40-GFP
Plasmid#65445PurposeExpression of GFP in mammalian cells. Control vector for FUW-ubiquitin-EphB-SV40-GFP vectorsDepositorInsertSV40-EGFP
UseLentiviralExpressionMammalianPromoterUBQ and SV40Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only