We narrowed to 21,470 results for: SPR
-
Plasmid#61477Purposebased on pDe-CAS9, encodes Cas9 D10A nickase variantDepositorInsertCas9-D10A
UseCRISPRExpressionPlantMutationcatalytic Asp10 changed to AlaPromoterPcUbi4-2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX458_Ruby
Plasmid#110164PurposeCas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNADepositorInserthSpCas9
UseCRISPRTags3xFLAG and Ruby2ExpressionMammalianAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1m_v1-RT
Plasmid#97089PurposeEncodes a HR repair template for knock-in a YFP expression cassette downstream of the poly(A) signal of human NEAT1_1 isoform. Best used with px330-NEAT1m_v1 vector.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SMC2-mAC donor (Hygro)
Plasmid#140648PurposeSMC2 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330A_D10A-1x5
Plasmid#58775PurposeExpresses Cas9 nickase and gRNADepositorInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJAT39
Plasmid#204289PurposeFor marking CRISPR HDR integrant with EGFP expressed in flight muscles.DepositorInsertMHC-EGFP+H3:H26
UseCRISPRPromoterMHCAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9
Plasmid#162162PurposeExpresses hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTagsN/AExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK4 gRNA (BRDN0001146469)
Plasmid#75876Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
loxP-Hygro-loxP-HA-mStayGold-Rab11 HR
Plasmid#229678PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with monomeric StayGold and an HA epitope tag. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY094-EFS-CD22-Blast-WPRE
Plasmid#192195PurposeLenti-CD22-OE-BlastDepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-BrCas12b
Plasmid#182276PurposeExpresses recombinant BrCas12bDepositorInsertBrCas12b
UseCRISPR and Synthetic BiologyTags6xHis, T7, Thrombin siteExpressionBacterialPromoterT7Available SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only