We narrowed to 27,285 results for: Tat
-
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 2-no linker
Plasmid#176921Purposeexpress Granulin 2 without linker 3 in mammalian cellsDepositorInsertGranulin 2 (GRN Human)
UseTagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianMutationPromoterAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 1+linker2
Plasmid#176918Purposeexpress Granulin 1 with linker 2 in mammalian cellsDepositorInsertGranulin 1+linker2 (GRN Human)
UseTagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianMutationPromoterAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli2 Pc-gE
Plasmid#51256PurposeEncodes N-3xHA-TEV-mouseGli2-C; amino acids 216,220,224,230,248 mutated to GluDepositorInsertGli2 (Gli2 Mouse)
UseFlpin systemTags3xHA-TEVExpressionMammalianMutationamino acids 216,220,224,230,248 mutated to GluPromoterEF1aAvailable sinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-TbID-emerin
Plasmid#175099PurposeLentiviral expression of V5-TbID-tagged mouse EmdDepositorInsertEmerin (Emd Mouse)
UseLentiviralTagsV5-TbIDExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-RR
Plasmid#108862PurposeFnCpf1 Gateway entry plasmid with N623R and K687R mutationsDepositorInsertFnCpf1-RR (FnCpf1 with N623R and K687R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationN623R and K687R, Cpf1 is rice codon optimizedPromoterAvailable sinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3-K51A
Plasmid#155265PurposeMammalian expression of rat LC3 fused to EGFPDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseTagspEGFPExpressionMammalianMutationLysine 51 to AlaninePromoterAvailable sinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3-R70A
Plasmid#155264PurposeMammalian expression of rat LC3 fused to EGFPDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseTagspEGFPExpressionMammalianMutationArginine 70 to AlaninePromoterAvailable sinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TEM4 R130D
Plasmid#58895PurposeExpresses GFP Tagged full length TEM4 protein with R130D mutation. Please see notes below for information regarding the L722F mutation in TEM4.DepositorInsertTEM4 (ARHGEF17 Human)
UseTagsEGFPExpressionMammalianMutationR130D, L722FPromoterCMVAvailable sinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rat Alpha2 delta-1 mutMIDAS pMT2
Plasmid#58730Purposeexpression of rat alpha2 delta-1 with MIDAS site mutations in mammalian cellsDepositorInsertalpha2 delta-1 (Cacna2d1 Rat)
UseTagsExpressionMammalianMutationMIDAS site mutations (D259VSGS to AVAGA)PromoterSV40Available sinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_Arg322Lys
Plasmid#105849PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Arg322Lys (EU numbering).DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
UseTagsExpressionMammalianMutationArg322Lys in constant region of IgG1 heavy chainPromoterhEF1-HTLVAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLgw EcoDam-V5-SRF
Plasmid#98602PurposeMammalian DamID lentiviral vector forSRF with Dam-V5 using Gateway cloningDepositorInsertSRF (Srf Mouse)
UseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianMutationPromoterHeat Shock Minimal PromoterAvailable sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35S:dCas9:Tnos (GB1191)
Plasmid#68223PurposeTranscriptional unit for human codon optimized with mutated (D10A, H840A) and inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoterDepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removed; human codon optimis…Promoter35SAvailable sinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 4+linker5
Plasmid#176924Purposeexpress Granulin 4 with linker 5 in mammalian cellsDepositorInsertGranulin 4+linker5 (GRN Human)
UseTagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
PA-RL-BAD
Plasmid#78859PurposeDULIP positive control (bait) for assay establishmentDepositorInsertBCL2 associated agonist of cell death (BAD Human)
UseExpression vectorTagsProtein A, Renilla luciferaseExpressionMammalianMutationPromoterCMVAvailable sinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-CCR5-VN
Plasmid#98963PurposeFLAG-tagged human CCR5 fused to N-terminus of split VenusDepositorInsertCCR5 (CCR5 Human)
UseTagsFLAG (dykdddd) epitope tag, Signal/leader sequenc…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SV40P-Tet1 enhancer E
Plasmid#63880PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet1DepositorInsertTet1 enhancer fragment E
UseLuciferaseTagsExpressionMammalianMutationPromoterSV40Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2201
Plasmid#115449PurposeConstitutive lentiviral expressionDepositorInsertsgQKI-2201 (QKI Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2204
Plasmid#115450PurposeConstitutive lentiviral expressionDepositorInsertsgQKI-2204 (QKI Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Klf4-pA-pgk-hph
Plasmid#74906PurposeMammalian expression of mKlf4DepositorInsertKlf4 (Klf4 Mouse)
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli2 P1-4A
Plasmid#51252PurposeEncodes N-3xHA-TEV-mouseGli2-C; amino acids 789,805,817,848 mutated to AlaDepositorInsertGli2 (Gli2 Mouse)
UseFlpin systemTags3xHA-TEVExpressionMammalianMutationamino acids 789,805,817,848 mutated to AlaPromoterEF1aAvailable sinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
PHAGE-P CMVt N-HA hE6-AP III (AA 1-84)
Plasmid#119319Purposelentiviral vector for expression of HA-Tagged E6-AP III AA 1-84 in mammalian cellsDepositorInsertE6-AP III (UBE3A Human)
UseLentiviralTagsHAExpressionMutationOnly AA 1-84PromoterCMVAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-CjeCas9-sgRNA (KAC482)
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-R273H-V5
Plasmid#167469Purposeectopic expression of hDDB2 in mammalian cellsDepositorInsertDDB2 (DDB2 Human)
UseTags6xHis and V5ExpressionMammalianMutationR273HPromoterCMVAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-Y2404F
Plasmid#182846Purposemutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 2011-2431 aa). Expression in E. coli. by IPTG inductionDepositorInsertTRR 2011-2431 (trr Fly)
UseTagsExpressionBacterialMutationmutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 20…PromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-MCS2-EF1-Puro-RGS7
Plasmid#113728PurposeExpress RGS7 in mamalian cellsDepositorInsertRGS7 (RGS7 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-CCR5-VC
Plasmid#98966Purposemyc-tagged human CCR5 fused to C-terminus of split VenusDepositorInsertCCR5 (CCR5 Human)
UseTagsSignal/leader sequence from Influenza A virus HA …ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001146083)
Plasmid#76910Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorInsertRIPK2 (RIPK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
UseTagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…PromoterAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9-plus
Plasmid#126774PurposeExpression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterT7Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMP108 Nanog-Venus-2a-mCherry
Plasmid#159743PurposeNanog targeting vector to insert fluorescent reporter of protein and gene expression levels from endogenous locus in mouse embryonic stem cells. Please see depositor comments for more detail.DepositorInsertNanog homeobox (Nanog Mouse)
UseMouse TargetingTagsVenus-2a-mCherryExpressionMutationPromoterAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-casBCDE(g8)
Plasmid#89727PurposeExpresses the Cascade subunits Cse2, Cas7, Cas5, Cas6e and pre-crRNA containing 33-nt spacer (referred to as 'wt') matching a protospacer in the M13 phage genome.DepositorInsertCRISPR array
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCMV:ECFP(loxP)(FRT)HNF1B
Plasmid#31439DepositorInsertHNF1B (HNF1B Human)
UseCre/Lox; Flp/frtTagsMycExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only