We narrowed to 4,936 results for: AAT
-
Plasmid#138708PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#2/Cre
Plasmid#173606PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMY-Ly6G-Rluc_miR
Plasmid#163339PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface markerDepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001148065)
Plasmid#76468Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(dAB)-luc
Plasmid#12423DepositorInsertM-CSF receptor promoter fragment (CSF1 Human)
UseLuciferaseMutationNo AML1 and C/EBP binding sites (delete bp -86 to…Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
PBK gRNA (BRDN0001147308)
Plasmid#75574Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001145396)
Plasmid#77633Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001162243)
Plasmid#77634Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX3X-ts3
Plasmid#174237PurposeDDX3X knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Human, Synthetic)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA3
Plasmid#220579PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF649_5-1)-PGKpuroBFP-W
Plasmid#212000PurposeExpress gRNA against ZNF649 with puro and BFPDepositorInsertsgRNA targeting ZNF649 (ZNF649 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shTAL1
Plasmid#210640PurposeKnockdown of TAL1 endogenous (3'UTR)DepositorInsertTAL1 3' UTR gRNA (TAL1 Human)
UseLentiviralAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCM2_d410-444_eGFP
Plasmid#208877PurposeExpress eGFP-CCM2 lacking amino acids 410-444 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g3 (BB24)
Plasmid#139459PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN261
Plasmid#91582PurposeExpress sgRNA targeting human CLUDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN254
Plasmid#91583PurposeExpress sgRNA targeting human CNOT1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLAU gRNA (BRDN0001145192)
Plasmid#77101Purpose3rd generation lentiviral gRNA plasmid targeting human PLAUDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only