We narrowed to 60,551 results for: promoter
-
Plasmid#86708PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA beta-catenin
Plasmid#18803Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expressionDepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA E-cadherin
Plasmid#18801DepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Lifeact-EGFP
Plasmid#58470PurposeExpresses a cytoplasmic actin filament reporter, the peptide Lifeact, on a CMV promoterDepositorInsertLifeact
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG
Plasmid#105537PurposeAAV expression of Cre from CMV promoterDepositorHas ServiceAAV rh10, AAV1, AAV2, AAV5, AAV8, and AAV9InsertCre
UseAAV and Cre/LoxExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-EGFP
Plasmid#63592PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone.DepositorInsertsCas9
EGFP
UseCRISPR and LentiviralTagsFLAG and P2AExpressionMammalianPromoterEFS-NSAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CamKII 0.4.Cre.SV40
Plasmid#105558PurposeAAV expression of Cre from CamKII promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertCre
UseAAV and Cre/LoxExpressionMammalianPromoterCamKIIAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-cdh1
Plasmid#11596DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
HA-FOXO3a TM
Plasmid#1788DepositorInsertFOXO3a (FOXO3 Human)
TagsHA (YDVPDYASL)ExpressionMammalianMutationT32A, S253A, S315A (no longer detectably phosphor…Available SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP44
Plasmid#22604DepositorAvailable SinceJan. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTRE-Tight-MitoTimer
Plasmid#50547PurposeExpresses the Timer protein targeted to the mitochondria under a Tet-inducible promoterDepositorInsertMitoTimer
ExpressionMammalianMutationF12S mutation in TimerAvailable SinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGFPGUSPlus
Plasmid#64401PurposeBinary plant vector expressing GFP and GUS, both driven by a 35S promoterDepositorInsertsGFP
GUSPlus
UseBinary vector for plant transformationTagsHisExpressionPlantMutationS65TPromoter35SAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA
Plasmid#154868PurposeHuman synapsin-1 promoter; Flp-dependent hM3D(Gq) DREADD-mCherryDepositorHas ServiceAAV Retrograde and AAV8InserthM3D(Gq)-mCherry
UseAAV; Flp-frtTagsmCherryExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hIR-GFP
Plasmid#22286DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-v2.1
Plasmid#167981PurposeExpresses CRISPRoff-v2.1 (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) downstream of the CAG promoterDepositorInsertCRISPRoff-v2.1 (DNMT3A-DNMT3L-dCas9-BFP-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pShuttle
Plasmid#16402PurposeShuttle vector for use in AdEasy System. Used for expression of transgenes under a chosen (non-CMV) promoter when no GFP tracer is desired.DepositorTypeEmpty backboneUseAdenoviralExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
SPDK3888(TRV-RNA2-pPEBV-MCS-AtIleu-tRNA)
Plasmid#149276PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
UseT-dna vectorMutationT2318C (DNA) in PEBV coat protein sequenceAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-DDB1
Plasmid#19918DepositorInsertDDB1 (Damage-specific DNA binding protein 1) (DDB1 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only