We narrowed to 24,262 results for: crispr
-
Plasmid#91694PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1 with sgRNA targeting SlDellaDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000563266)
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB9v2
Plasmid#210029PurposeContains cloning site for molecularly-tagged Cas9 gRNA constructs, inducible Cas9, rtTA-T2A-puroDepositorInsertsCas9
rtta-T2A-puro
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTE4398
Plasmid#74042PurposeExpresses human codon-optimized LbCpf1 and Lb crRNA.DepositorInsertsLb crRNA
LbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTDH3-dCas9
Plasmid#46920PurposeYeast CEN/ARS vector (Leu2) that contains dCas9 fused to NLS controlled by TDH3 promoterDepositorInsertdCas9
UseCRISPRExpressionYeastPromoterTDH3Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pdCas9::BFP-humanized
Plasmid#44247PurposeExpression of a catalytically inactive, human codon-optimized Cas9-BFP fusion under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdownDepositorInsertdCas9 fused to BFP
UseCRISPR and RetroviralTags2xNLS & tagBFPExpressionMammalianMutationD10A H840A (catalytically inactive)PromoterMSCV LTR promoterAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pY001 (pFnCpf1_full)
Plasmid#69973PurposeExpresses FnCpf1 locus including Cas genes and spacers 1-4 of CRISPR array.DepositorInsertFnCpf1 locus
UseCRISPRExpressionBacterialAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pV1393
Plasmid#111430PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Dual-iCas9-EFS
Plasmid#167501PurposeExpression of dual inducible Cas9 with EFS promoterDepositorInsertCas9
UseCRISPR, Lentiviral, and LuciferaseTagsFLAGExpressionMammalianPromoterEFSAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pScRad52-SpCas9 (pXK-1646)
Plasmid#208823PurposeCRISPR/Rad52-Cas9 expression vector for Animal gene editing, harboring the ScRad52-SpCas9 and a VEGFA.gRNA expression cassette. Key Construct: hU6-VEGFa.gRNA-CMV-ScRad52-SpCas9.DepositorTypeEmpty backboneUseCRISPR; Cas9TagsRad52ExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP
Plasmid#114729Purpose3 sgRNAs targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5, sgRNA M7, sgRNA M9
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-LoxP-Neo-N-miRFP670-C
Plasmid#159434PurposeCRISPR knock-in donor construct with fluorescent reporter and removable selectable markerDepositorInsertsNeomycin
miRFP670
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterSV40Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK Cas9-2A-Citrine
Plasmid#92393PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.DepositorInsertCas9 2A Citrine
UseCRISPRExpressionMammalianPromoterthymidine kinase promoterAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-SVI-DIO-dCas9-VPR
Plasmid#164576PurposeExpresses a SYN-driven, intron-containing dCas9-VPR fusion in which the part of the dCas9 cassette is double floxed and in inverted orientation (DIO). Requires Cre-dependent recombination.DepositorInsertA DIO FLAG-dCas9-VPR cassette containing an SV40 intron
UseCRISPR, Cre/Lox, and LentiviralTagsFLAGExpressionMammalianAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS477-pHAGE-TO-Spy dCas9 3XmCherry-SgRNA/Telomere-All-in-one
Plasmid#85717PurposeExpresses dSpyCas9-3XmCherry and telomere-targeting Spy sgRNADepositorInsertsSp dCas9
telomere sgRNA
UseCRISPR and LentiviralTags3XmCherryExpressionMammalianPromoterCMV-TO and U6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only