We narrowed to 24,897 results for: SPR
-
Plasmid#104439PurposeDestination vector expressing plant-codon-optimized Cas9 under 35S promoter, with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene freeDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoter35SAvailable SinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCfB3034(X-3 MarkerFree)
Plasmid#73272PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-3 (Chr X: 223616..224744)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBB4B
Plasmid#207785PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TUBB4B for knock-in.DepositorInsertsgRNA Targeting C-terminus of TUBB4B (TUBB4B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_744
Plasmid#176663PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029744) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CIC_iso1
Plasmid#135728PurposeDonor vector for 3' FLAG tag of human CIC_iso1DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1217
Plasmid#119258Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOC1 Gria1-GFP-FRB KI
Plasmid#183428PurposeCreOFF knock-in for GluA1-GFP-FRB (amino acid position: stop codon)DepositorInsertgRNA and GFP-FRB donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTZ tRNA_gRNA empty scaffold
Plasmid#188450PurposeExpression of gRNAs using a human tRNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotertRNA glutamineAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH1
Plasmid#164800PurposeFor CRISPRi knockdown of ERH by lentiviral delivery of ERH gRNA1DepositorInsertsERH CRISPRi gRNA1
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH2
Plasmid#164801PurposeFor CRISPRi knockdown of ERH by lentiviral delivery of ERH gRNA2DepositorInsertsERH CRISPRi gRNA2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1069
Plasmid#119244Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1161
Plasmid#119251Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK503
Plasmid#155380PurposedCas12a oscillator, same direction crRNAs. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceMay 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV/MASC_(GLuc)_INT
Plasmid#68440PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/ MASC expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB2899(X-2 MarkerFree)
Plasmid#73271PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-2 (Chr X: 194944..195980)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_zeo
Plasmid#184910PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1071
Plasmid#119245Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
LentiU6-hNEUROD1 gRNA_1-MS2-Puro
Plasmid#192676PurposeLentiviral expression of sgRNA targeting hNEUROD1 promoter to activate human NEUROD1 transcriptionDepositorInsertHuman NEUROD1 activating gRNA #1 (NEUROD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC031 - RcrCas13a from Rhodobacter capsulatus R121
Plasmid#91921PurposeExpresses RcrCas13a for bacterial expression and contains backbone for spacer cloningDepositorInsertRcrCas13a and guide expression cassette
ExpressionBacterialAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Cas9-RFC5
Plasmid#183200PurposeEntry cloneDepositorInsertCas9-RFC5
UseCRISPR; Gateway entry cloneMutationn/aAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV489
Plasmid#177697PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ) and TDH3p (Candida…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1290
Plasmid#119267Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC027 - LweCas13a from Listeria weihenstephanensis FSL R9-0317
Plasmid#91917PurposeExpresses LweCas13a for bacterial expression and contains backbone for spacer cloningDepositorInsertLweCas13a and guide expression cassette
ExpressionBacterialAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_596
Plasmid#176655PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO_Malat1_D
Plasmid#72623PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJMP1067
Plasmid#119243Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1102
Plasmid#119246Purposeknockdown phzA1 in P. aeruginosaDepositorInsertsgRNA phzA1 (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1103
Plasmid#119247Purposeknockdown phzM in P. aeruginosaDepositorInsertsgRNA phzM (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1055
Plasmid#119242Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-GSX2-tTA-BleoR
Plasmid#161748PurposeTet-ON tTA plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertAdvanced tTA
UseCRISPRExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
Plasmid#170183PurposeExpression vector for a sgRNA against BFP and spCas9 linked to mCherry via a T2A peptideDepositorInsertsgBFP
ExpressionMammalianPromoterhU6Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[P4-P6(3xPP7)]
Plasmid#68432PurposeTransient expression in mammalian cells of an "INT" construct_bearing P4_P6 (internally appended with three PP7 stem-loops), targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing P4_P6 (internally appended with three PP7 stem-loops)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
1530_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-EmGFP-spA
Plasmid#109317PurposePlasmid for liver-specific expression of EmGFP with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pJZC625
Plasmid#62321PurposesgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cellsDepositorInsertsgRNA +1x MS2, Pol II promoter with ribozyme cleavage
ExpressionYeastPromoterpAdhAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only