We narrowed to 25,947 results for: p
-
Plasmid#177329PurposeCo-expression of the human active Cdk1/cyclin B1/Cks1 kinase complexDepositorInsertsTags2 x Strep-tag and 8 x HisExpressionInsectPromoterp10 and polhAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCG-TPMV Hd32
Plasmid#163963PurposeExpresses TPMV H glycoprotein in mammalian cellsDepositorInsertTPMV H glycoprotein
ExpressionMammalianMutationAmino acids 2 to 33 at N terminus deletedAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-eGFP
Plasmid#167585PurposeExpresses human CPSF6 fused to eGFPDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-OFF hM4Di-mCherry
Plasmid#161579PurposeTo express hM4Di in cells not expressing Cre.DepositorInserthM4Di-mCherry
UseAAVMutationNAPromoterhSynAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
CTB
Plasmid#141166PurposeExpresses recombinant Cholera Toxin B SubunitDepositorInsertCTB
ExpressionBacterialMutationNo secretion signalPromoterT7Available SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2-Fc(IgG1)
Plasmid#145165PurposeMammalian expression plasmid for soluble ACE2-Fc fusion (IgG1) high affinity 2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFc region of human IgG1ExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHMR1A
Plasmid#102957Purposegene cloning of MR1ADepositorAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPMVAu8
Plasmid#98297PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of consitutive promoters.DepositorInsertPRPL4A-EfmvaS-TEFM1-PRPL15A-EfmvaE -TEBS1
ExpressionYeastAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-nArgBP2
Plasmid#74514PurposeExpress GFP-nArgBP2 fusion protein in mammalian cellsDepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pER-eZinCh-2
Plasmid#70009Purposeexpresses ER-eZinCh-2 Zn2+ FRET sensor in the ER of mammalian cellsDepositorInsertER-eZinCh-2
TagsKDEL sequence and PPI signalExpressionMammalianPromoterCMVAvailable SinceNov. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN41
Plasmid#61344PurposemCherry fused to LINuS, a light-inducible nuclear localization signal (biNLS9/PKIt NES)DepositorInsertmCherry
TagsGS linker-AsLov2-biNLS9 and PKIt NESExpressionMammalianPromoterCMVAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-mFoxP1-ES
Plasmid#35169DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRK-ATF4 1-275
Plasmid#26118DepositorAvailable SinceMarch 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mSMAD
Plasmid#230917PurposeTested the COL1A1 promoter activity after abolition of the proximal SMAD binding sites in the promoter.DepositorInsertHuman COL1A1 promoter with mutant SMAD binding sequence (COL1A1 Human)
UseLuciferaseTagsLuciferase-luc2pExpressionBacterial and MammalianMutationCOL1A1 promoter with mutant potential SMAD bindin…PromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GSDMD-eGFP-SV40p-BlasR
Plasmid#228254PurposepLenti-CMV-GSDMD-eGFP-SV40p-BlasR plasmid for ectopic expression of human full-length GSDMD fusion with GFPDepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (A7)
Plasmid#174078PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only