We narrowed to 2,915 results for: GFP reporter gene
-
Plasmid#140425PurposeAAV.CBA.eGFP.2A.P301L-Tau propagation reporter P301L-2N4R-hTauDepositorInserteGFP-2A-Tau(P301L) (MAPT Synthetic, Human)
UseAAVTagseGFPMutationchanged Proline 301 to LeucinePromoterCBAAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-ATF4uORF1-2-GFP-IRES-mCherry
Plasmid#226105PurposeATF4uORF1-2 stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cells to read out activation of the integrated stress response (ISR)DepositorInsertatf4 (ATF4 Human)
TagsGFPExpressionMammalianMutationcontains uORF1-2 of ATF4, whose stability can ser…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-SET-EMD (N-SET-EMD)
Plasmid#217765PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSET-EMD-EGFP (C-SET-EMD)
Plasmid#217764PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSCAR_Cas9-blast_GFP
Plasmid#162074Purpose3rd generation lentivirus transfer vector for Cre-removable Cas9, GFP reporter, and blast resistanceDepositorInsertsCas9-2a-blasticidin S deaminase
EGFP
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianMutationcodon-optimized for expression in M. musculusPromoterEF1a and sv40Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_Cas9-hygro_GFP
Plasmid#162075Purpose3rd generation lentivirus transfer vector for Cre-removable Cas9, GFP reporter, and hygro resistanceDepositorInsertsCas9-2a-hygromycin B phosphotransferase
EGFP
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianMutationcodon-optimized for expression in M. musculusPromoterEF1a and sv40Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ ARHGAP5 5' and 3'UTR
Plasmid#67931PurposeTranslational reporter - ARHGAP5 UTRsDepositorAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
[#GS15-LV] DsRed GFP TEVp Blast Switch - Recipient
Plasmid#233506PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxp eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-SV40-Puro-CMV-mCherry-EGFP-LC3B
Plasmid#223712PurposeExpresses autophagy flux LC3B fluorescence reporterDepositorInsertLC3B (MAP1LC3B Synthetic, Human)
UseLentiviral and Synthetic BiologyTagsmCherry::EGFP::LC3BExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
hEF1α-H2B-mOrange2-IRES-EGFP PGK-Puromycin
Plasmid#99277PurposeDual fluorescent reporter - constitutive expression of mOrange2 (549/565) localized in the nucleus, EGFP (488/507) untargeted and visualized in the cytoplasm, and Puromycin resistanceDepositorInsertsH2B-mOrange2-IRES-EGFP
Puro
UseLentiviralTagsEGFP, H2B, IRES, PGK, and mOrange2PromoterEF1 alpha-human and PGK-mouseAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K20-P2A-mCherry
Plasmid#185618PurposeRibosomal stalling reporter: positive controlDepositorInsertGFP-K20(AAA)-mCherry
ExpressionMammalianPromoterCMVAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-I15-P2A-mCherry
Plasmid#185620PurposeRibosomal stalling reporter: 15x isoleucineDepositorInsertGFP-I15-mCherry
ExpressionMammalianPromoterCMVAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
EW378 (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-GFP
Plasmid#236134PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNF250 bindi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW411 (UTRN-43-5bp spacer-UTRN-14)-H2B-GFP
Plasmid#236148PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the UTRN promoter region encompassing 14 to 67 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the UTRN promoter regionAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW407 (ZNF35/ZNF35-6bp spacers)x4-H2B-GFP
Plasmid#236137PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNF250 bindi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW387 (ZNF35/IKZF1tar-6bp spacers)x4-H2B-GFP
Plasmid#236138PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNFIKZF1 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNFIKZF1 bin…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-cDELE1(142-515)-GFP-IRES-mCherry
Plasmid#226102PurposecDELE1 (corresponding to mitochondrially imported, cleaved DELE1, residues 142-515) stability reporter construct for transient expression in mammalian cellsDepositorInsertDELE1 (DELE1 Human)
TagsGFPExpressionMammalianMutationonly encodes for residues 142-515 of DELE1 corres…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-Lyn-GFP-bGH]
Plasmid#196884PurposeDual Cre/Dre-dependent expression of LynGFP. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-Lyn-GFP-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapERK)d1EGFP (KroxDs)
Plasmid#214912Purposefor PiggyBac mediated integration and stable expression of destabilised EGFP as a reporter to MAPK/ERK pathway activationDepositorInsertd1EGFP under the MapERK promoter
ExpressionMammalianPromoterMapkERK promoterAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-EGFP (C-KSR)
Plasmid#217753PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSico-CAG-v-H-Ras-IRES-Luciferase/EGFP
Plasmid#58959Purposelentiviral expression of v-H-Ras and luciferase/EGFP reporterDepositorInsertsCMV enhancer/chicken beta actin promoter
v-H-Ras
luc2/EGFP fusion gene
UseLentiviralExpressionMammalianPromoterCMV enhancer/chicken beta actinAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
SOX9-T2A-H2B-EGFP repair template
Plasmid#167972PurposeSOX9 reporter repair templateDepositorInsertSRY-Box Transcription Factor 9 (SOX9 Human)
UseCRISPR; Donor templateTagsH2B-EGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EmGFP-LATS2/1 KD
Plasmid#52085PurposeLentiviral RNAi vector for knockdown of LATS2 and LATS1. Co-expresses EmGFP as reporterDepositorAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
LSM081 SFFV-mCherry-SGc(stem-1(3xMS2)2-stops)cSG-EGFP (FLP-IN)
Plasmid#233440PurposeSFFV driven LIDAR reporter with an additional stop codon on the stem loopDepositorInsertSGc(stem-1(3xMS2)2-stops)cSG-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ388 (IVT) CMV-TO-T7-EGFP-SGc(stem-1(3xMS2))cSG-Cre-hybridUTR3
Plasmid#233424PurposeIVT template for LIDAR reporter mRNA; EGFP as marker, Cre recombinase as outputDepositorInsertT7-EGFP-SGc(stem-1(3xMS2))cSG-Cre-hybridUTR3
ExpressionMammalianMutationWTPromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Lyn-EGFP
Plasmid#196875PurposeNeuron-specific expression of LynGFP reporterDepositorInsertLynEGFP
UseCre/LoxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hDNAJC6-T2A-copGFP
Plasmid#170443PurposeLentiviral vector expressing human DNAJC6 with copGFP reporter gene, under control of EF1alpha promoterDepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2X-KSR1-CA3-EGFP (2x-C-KSR)
Plasmid#217756PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationTwo tandem CA3 domain (aa 317-400) 1st linker GG…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
[#GS7-LV] DsRed GFP TEVp Zeo Switch - Recipient
Plasmid#233507PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxP eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTSmut-cox8A(XXXX)-GFP-IRES-mCherry
Plasmid#226104PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) with mutations that impair recognition by SIFI for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
TagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNES-PRKCZ-C20-EGFP (C-NES-PRKCZ-C20)
Plasmid#217763PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationNES (ALQKKLEELELDEAPVAT) plus C20 domain (aa 405-…PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
EW265 SFFV-mCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP (FLP-IN)
Plasmid#236124PurposePlasmid encoding fluorescent reporter for PUF-9R binding which expresses mCherry constitutively and EGFP upon stop codon deamination due to ADAR-PUF9R bindingDepositorInsertmCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP
ExpressionMammalianPromoterSFFVAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPORT1[attB/Ins1/NbT promoter/glGFP/bglobin 3'-UTR/Ins2]
Plasmid#74102Purposeplasmid driven under neuronal beta-tubulin promoter, bearing attB and two insulator sequences (opposite directions pointing inward towards the reporter gene)DepositorInsertsXenopus laevis beta-tubulin gene promoter region and 5'UTR
Green Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
ExpressionBacterialAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSbi-pur-EGFP-KSR1-CA3 (N-KSR)
Plasmid#217769PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseSleeping beauty transposase-compatible genome ins…TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterEF-1alpha promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits