We narrowed to 10,545 results for: Uty
-
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only
-
nes714tk/lacZ
Plasmid#47614Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intronPromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-CD36-C-10
Plasmid#56104PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAF197
Plasmid#135930PurposeAll-in-one Sleeping Beauty vector for Expression for Tasmanian devil CTLA4-Fc-mCherry fusion protein. Multiple cloning sites to swap genes-of-interest (i.e. CTLA4).DepositorInsertCTLA4 fused to IgG Fc and to mCherry
UseTransposonTagsmCherryExpressionMammalianPromoterEF1aAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJM186A
Plasmid#218127PurposeHybrid circuit displaying hsCRBN bait and driving expression of gIIIDepositorInsertsTags434cI_RR69Available SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
3019_pETcon-SARS-CoV-2-RBD_E484K
Plasmid#184404Purposeyeast surface display of the SARS-CoV-2 Eta variant RBDDepositorInsertSARS-CoV-2 Eta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationE484KAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(Δ71)-mCherry
Plasmid#92425PurposeExpression of fusion incompetent VAMP3 (del71) C-terminally conjugated to mCherry.DepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationdeleted leucine 71PromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEXneo-TrkC
Plasmid#190202PurposeTo express the Human TrkC receptor under the Moloney mouse sarcoma virus LTR.DepositorInsertTrkC (NTRK3 Human)
UseEucaryoticExpressionMammalianPromoterMoloney mouse sarcoma virus LTRAvailable SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
tdEos-Vimentin-7
Plasmid#57688PurposeLocalization: Intermediate Filaments, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 R425V
Plasmid#47898PurposeExpresses myc tagged Miro2 R425V constitutively active mutantDepositorInsertMiro2 R425V (RHOT2 Human)
TagsmycExpressionMammalianMutationR425V, constitutively active mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_Arg322Lys
Plasmid#105849PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Arg322Lys (EU numbering).DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationArg322Lys in constant region of IgG1 heavy chainPromoterhEF1-HTLVAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80N2 (1-406)
Plasmid#29442DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation2nd intron onlyPromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
Nsp14D-mCherry
Plasmid#165139Purposemammalian expression and localizationDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nsp4 deltaC-EGFP
Plasmid#165126Purposemammalian expression and localizationDepositorAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only