We narrowed to 68,416 results for: TOR;
-
Plasmid#124927PurposeFor expression of NCD (a.a. 1-139) of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT4G23740 J11_pECIA2
Plasmid#114998PurposeBait vector AT4G23740 J11_pECIA2 should be used with prey vector AT4G23740 J11_pECIA14.DepositorInsertAT4G23740 (AT4G23740 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128343PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac (GST-SNAP-Shp2)
Plasmid#177897PurposeBaculo expression of GST tag fused to SNAP tag and human Shp2DepositorInsertShp2 (PTPN11 Human)
TagsTEV-GST-PreScission cut site-SNAP tagExpressionInsectPromoterPolyhedrinAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ARMET-bio-His
Plasmid#52026PurposeExpresses full-length Mesencephalic astrocyte-derived neurotrophic factor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertARMET (MANF Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C - AVITEV
Plasmid#74058Purposeretroviral expression plasmid for human NFATc2/C with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a-Med25-VBD-6His
Plasmid#64773PurposeBacterial expression of His-tagged Med25-VBDDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
EPHB1-bio-His
Plasmid#51750PurposeExpresses full-length Ephrin type-B receptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertEPHB1 (EPHB1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
ps-3HA-Beta2-PSCFP2-N
Plasmid#114186Purposestudying clustering of Beta2 receptors by superresolution microscopy (PALM)DepositorInsertAdrenergic receptor beta 2 (ADRB2 Human)
Tags3HA and PS-CFP2ExpressionMammalianPromoterSV40Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
MPL-bio-His
Plasmid#53339PurposeExpresses full-length Thrombopoietin receptor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertNM_005373.2 (MPL Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-NCBD + ACTR
Plasmid#99335PurposeBacterial coexpression of CBP NCBD and NCoA3 binding domainsDepositorExpressionBacterialPromoterT7Available SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTarget_AT1R-tTA
Plasmid#222851PurposeMammalian expression plasmid encoding the human Angiotensin II type I receptor fused to the tTA transcriptional activatorDepositorAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
AT5G62710 X045_pECIA2
Plasmid#115130PurposeBait vector AT5G62710 X045_pECIA2 should be used with prey vector AT5G62710 X045_pECIA14.DepositorInsertAT5G62710 (AT5G62710 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AR-R405A
Plasmid#126052PurposeExpresses human androgen receptor (R405A) in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G35710 X075_pECIA2
Plasmid#115098PurposeBait vector AT1G35710 X075_pECIA2 should be used with prey vector AT1G35710 X075_pECIA14.DepositorInsertAT1G35710 (AT1G35710 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G56140 X032_pECIA2
Plasmid#115062PurposeBait vector AT1G56140 X032_pECIA2 should be used with prey vector AT1G56140 X032_pECIA14.DepositorInsertAT1G56140 (AT1G56140 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G06840 X062_pECIA2
Plasmid#115052PurposeBait vector AT1G06840 X062_pECIA2 should be used with prey vector AT1G06840 X062_pECIA14.DepositorInsertAT1G06840 (AT1G06840 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT2G19230 M11_pECIA2
Plasmid#114949PurposeBait vector AT2G19230 M11_pECIA2 should be used with prey vector AT2G19230 M11_pECIA14.DepositorInsertAT2G19230 (AT2G19230 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G29730 X066_pECIA14
Plasmid#114855PurposePrey vector AT1G29730 X066_pECIA14 should be used with bait vector AT1G29730 X066_pECIA2.DepositorInsertAT1G29730 (AT1G29730 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G02880 J3_pECIA14
Plasmid#114790PurposePrey vector AT3G02880 J3_pECIA14 should be used with bait vector AT3G02880 J3_pECIA2.DepositorInsertAT3G02880 (AT3G02880 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G51890 M5_pECIA14
Plasmid#114744PurposePrey vector AT1G51890 M5_pECIA14 should be used with bait vector AT1G51890 M5_pECIA2.DepositorInsertAT1G51890 (AT1G51890 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS6-TGFB2-STREP
Plasmid#128503PurposeExpresses human pro-TGFβ2 (from L21 to S414) in mammalian cells. With N-t STREP(2x) tag.DepositorAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gal4-VP16-HSF1 WT
Plasmid#71726Purposeplasmid expressing fusion construct of Gal4 BDB VP16 AD and HSF1 WT RDDepositorInsertGal4 DBD HSF1 VP16 AD (HSF1 Herpes Simplex Virus protein VP16, Budding Yeast, Human)
ExpressionMammalianAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
AT1G66830 X005_pECIA14
Plasmid#114810PurposePrey vector AT1G66830 X005_pECIA14 should be used with bait vector AT1G66830 X005_pECIA2.DepositorInsertAT1G66830 (AT1G66830 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta2-29
Plasmid#124923PurposeFor expression of a.a.2-29 deletion mutant of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G48740 O3_pECIA2
Plasmid#114963PurposeBait vector AT5G48740 O3_pECIA2 should be used with prey vector AT5G48740 O3_pECIA14.DepositorInsertAT5G48740 (AT5G48740 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G59650 O4_pECIA2
Plasmid#114964PurposeBait vector AT5G59650 O4_pECIA2 should be used with prey vector AT5G59650 O4_pECIA14.DepositorInsertAT5G59650 (AT5G59650 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab7A
Plasmid#135651PurposeRab7A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR-W741C-S81A
Plasmid#171248PurposeMammalian expression of 3xFlag-tagged human androgen receptor phosphorylation mutant that binds to bicalutamide: AR-Trp741Cys-Ser81Ala (AR-W741C-S81A)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys-Ser81Ala mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys-Ser81Ala (AR-W741C-S81A)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR-W741C-S81D
Plasmid#171249PurposeMammalian expression of 3xFlag-tagged human androgen receptor phosphorylation mutant that binds to bicalutamide: AR-Trp741Cys-Ser81Asp (AR-W741C-S81D)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys-Ser81Asp mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys-Ser81Asp (AR-W741C-S81D)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AR-R405S
Plasmid#126051PurposeExpresses human androgen receptor (R405S) in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A-PIK3CA E545K
Plasmid#180032PurposeEntry vector of PIK3CA E545K for gateway cloning.DepositorAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only