172,500 results
-
Plasmid#119300PurposeExpresses C-terminus of split luciferase fused to P3 coil, PPVs cleavable linker and autoinhibitory coil AP4/for split protease-cleavable orthogonal Coiled-coil (SPOC) logicDepositorInsertsplit cLuc fused to P3coil-PPV cleavage site and autoinhibitory coil AP4mS
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pp-CBBC-Fluc
Plasmid#232920PurposeAllows the Golden Gate (BsmBI) cloning of pegRNA between two Csy4-hairpins in the intron of a CMV-FLUC encoding plasmid (POL II): ipegRNAs must be processed by Csy4 in VLP- producer cells.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDawn-sfGFP
Plasmid#107741PurposeExpresses superfolder GFP under the control of a blue-light transcriptional regulatorDepositorInsertsuperfolder GFP
ExpressionBacterialPromoterpLambdaAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXAT2
Plasmid#80494PurposeAAVS1 sgRNA expression vectorDepositorInsertAAVS1 sgRNA-T2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_hfCas13d(RfxCas13d_N2V8)_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190034Purposevector for encoding a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13d
ExpressionMammalianMutationA134V,A140V,A141V,A143VPromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRN111
Plasmid#84463PurposepJB38-NWMN29-30 + SarA_P1-mCherry-TermDepositorInsertSarA_P1-mCherry from pRN11
Available SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMV306hsp+LuxG13
Plasmid#26161DepositorInsertBacterial luciferase operon + G13 promoter
ExpressionBacterialMutationIt contains a gram-positive enhanced translation …Available SinceFeb. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_Sec61B-V5-APEX2
Plasmid#83411PurposeExpressed C-term tagged APEX2 on Sec61B in mammalian cellDepositorInsertSec61B-V5-APEX2 (SEC61B Synthetic, Human)
TagsAPEX2 and V5ExpressionMammalianPromoterCMV-FAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA Arf1
Plasmid#10830DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry_P2AT2A_GFP-nb-2xKS
Plasmid#238236PurposeFor overexpression of mCherry_P2AT2A_GFP-nb-2xKSDepositorInsertmCherry_P2AT2A_GFP-nb-2xKS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-nbOcIgG-Tn5
Plasmid#184285PurposeAnti-rabbit IgG Fc specific nanobody-Tn5 for NTT-seq (multiplexed CUT&Tag)DepositorInsertnbOcIgG-Tn5
Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TurboID-3MYC-natMX6 (pFB1434)
Plasmid#126050PurposeFor C-terminal tagging with TurboID in yeast including nourseothricin-resistant markerDepositorInsertTurboID
UsePcr-based c-terminal taggingAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
ZCCHC6
Plasmid#156140PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHis-BRD4 BD1
Plasmid#196544PurposeExpression of BRD4 Bromodomain (BD1) in E.coliDepositorAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0477
Plasmid#144359PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMU-ACTLr
Plasmid#61193PurposeFluorescent reporter for F-actin LifeAct-mCherry expressed under AtUBQ10 promoterDepositorInsertLifeAct-mCherry
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGCDNsam-Hnf4a-IRES-GFP
Plasmid#33006DepositorInserthepatic nuclear factor 4 alpha (Hnf4a Mouse)
UseRetroviralAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only