We narrowed to 12,952 results for: sequence
-
Plasmid#190736PurposeMammalian expression of EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertensconsin (MAP7 Human)
UseTagsMyc, TurboID, and V5ExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pPFK300_Cas9
Plasmid#104910PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA RBM20
Plasmid#162735PurposeMammalian expressionDepositorInsertSpacer sequence for RBM20
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Unc5B-FLAG
Plasmid#72195PurposeExpresses full-length Unc5b with a C-terminal FLAG tagDepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBXNPHM3
Plasmid#110099PurposeE.coli expression vector for FX cloning system, N-terminal pelB signal sequence followed by 10xHisTag, maltose binding protein and 3C cleavage siteDepositorTypeEmpty backboneUseTagsHisExpressionBacterialMutationPromoterAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLGB36
Plasmid#135621PurposeSuicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselectionDepositorInsertbfe3
UseBacteroides suicide vector with inducible counter…Tagssignal sequence for periplasmic targetingExpressionMutationPromoterBacteroides promoter regualted by TetR transcript…Available SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWAP-HGF
Plasmid#83503PurposeGeneration of transgenic mice overexpressing the HGF under the control of the WAP gene promoterDepositorInsertHGF (Hgf Mouse)
UseMouse TargetingTagsExpressionMutationalso contains beta-globin sequences from pUC198Promotermouse WAP (whey acidic protein)Available SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
UseTagsExpressionYeastMutationPromoterCryptococcus Histone3 promoterAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hSOX10
Plasmid#24749DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorTagsExpressionMutationwildtype sequencePromoterAvailable SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUF1-dCas9-GCN5
Plasmid#122509PurposeCombining with the specific sgRNA sequence to activate of the Plasmodium falciparum endogenous gene transcription, through the increasing of H3K9 acetylation.DepositorInsertdCas9-GCN5
UseCRISPRTags3*FLAGExpressionMutationdCas9(D10A,H840A)PromoterPfHsp86Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-CCR5
Plasmid#98949PurposeMammalian expression plasmid for N-terminal FLAG-tagged human CCR5DepositorInsertCCR5 (CCR5 Human)
UseTagsFLAG (dykdddd) epitope tag and Signal/leader sequ…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSL3927 (pDonor(plasmid)_Pse)
Plasmid#200905PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016,with a CmrR cargo, as well as a primer binding site for deep sequencing purposes at pTarget. Total transposon size = 1,087 bp.DepositorInsertMini Tn7016 (pTarget NGS)
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
hCD4-mOrange
Plasmid#110192PurposeEncodes for human CD4 coding sequence tagged with the mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
p415 TEF Su9‐roGFP2‐Tsa2ΔCR
Plasmid#83240PurposeThe genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For mitochondrial matrix expression.DepositorInsertSu9-roGFP2-Tsa2dCr
UseTagsroGFP2 fusion with Tsa2dCr with Su9 targetting se…ExpressionYeastMutationPromoterTEFAvailable SinceNov. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minCMVe-SCP1-SaCas9-W3SynpA
Plasmid#231370PurposeSCP1 promoter-driven SaCas9 with truncated CMV enhancer and short synthetic terminator sequence.DepositorInsertSaCas9
UseAAVTagsExpressionMutationPromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Plxna4-Fc-His
Plasmid#72125PurposeExpresses the extracellular region of the PlexinA4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG1336
Plasmid#167303PurposeLevel 0 module (3U+Ter) for further assemblies based on the Modular Cloning system. 3'UTR and flanking sequence of a Solanum lycopersicum Oleosin gene, arbitrarily called OLE2 (Sollyc03g112440)DepositorInsert3'UTR and Terminator SlOLE2
UseSynthetic Biology; Moclo level 0 vectorTagsExpressionMutationPromoterAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFS_1113_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23103-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184741Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 2 transcribed by BBa_J23103DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
UseTagsExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCMV-EGFP-eDHFR(69K6)-MCS
Plasmid#172100PurposeMammalian expression of a protein of interest fused to the C-terminus of EGFP-eDHFR(69K6)DepositorInsertEGFP-eDHFR(69K6)-20aa
UseTagsExpressionMammalianMutationeDHFR(69K6): Hexalysine (K6) sequence is inserted…PromoterCMVAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AA332
Plasmid#216053PurposeFragmid fragment: (C' terminus) 3x NLS sequencesDepositorHas ServiceCloning Grade DNAInsertSV40NLS_v1.10; SV40NLS_v1.11; SV40NLS_v1.12
UseFragmentTagsExpressionMutationPromoterAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVTagsExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH231-Bx-GFP-C31
Plasmid#115149PurposeEmpty safe harbor site 231 knock-in vector with flanking homology arms and Bxb1 and C31 attP integrase landing padsDepositorInsertSafe Harbor Homology Sequences
UseTagsExpressionMammalianMutationPromoterAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
Perox-mTurq2-Apollo-NADP+
Plasmid#193304PurposeExpresses mTurq2-Apollo-NADP+ sensor localized to the peroxisomeDepositorInsertG6PD (G6PD Human)
UseTagsmTurqoise2, peroxisomal targeting sequenceExpressionMammalianMutationS40A, R72Q, H201N, K205TPromoterT7Available SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3e UbB polyA
Plasmid#188702PurposeGateway 3' element encoding the ubiquitin B polyadenylation sequenceDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-TA MAO-IRES-Puromycin
Plasmid#133025PurposeExpresses EGFP-tagged tail anchor sequence of monoamine oxidase ADepositorInsertMonoamine oxidase type A (MAOA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 1-488PromoterHuman elongation factor 1 alphaAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFS_1142_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23103-Leader1-ARRAY1-DR1-FaqI_Term_NotI
Plasmid#184742Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 1 transcribed by BBa_J23103DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
UseTagsExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only