We narrowed to 1,599 results for: ICL
-
Plasmid#194298PurposeE. coli expression vector for monobody adaptor, FCM101, that bind to the Fc region of mouse IgG1 subclass. It contains a single Cys residue at the C-terminus for chemical conjugation, N-terminal His6DepositorInsertFCM101
TagsHis tag, FLAG tagExpressionBacterialPromoterT7Available SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hygro(+)-PSTCD-cGAS-delta DBD
Plasmid#102606PurposeMammalian expression of mutant cGAS with deletion of DNA binding domain fused to PSTCD tagDepositorInsertcGAS (CGAS Human)
ExpressionMammalianMutationdelta K173-I220 and delta H390-C405PromoterCMVAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMygro
Plasmid#82503PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.DepositorInserteGFP-IRESMygro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMuro
Plasmid#82504PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInserteGFP-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab7A
Plasmid#135651PurposeRab7A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Luc2-IRESMeo
Plasmid#82509PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.DepositorInsertLuc2-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTFG001-ACE2(WT)-HA
Plasmid#191569PurposeACE2 insert in a 2nd generation lentiviral transfer plasmid (pGIPZ) to generate ACE2(WT)-expressing cells. Codon-optimized for human expression. Insert contains C-terminal HA tag.DepositorInsertAngiotensin Converting Enzyme II (ACE2 Human)
UseLentiviral and RNAiTagsHA tagExpressionMammalianMutationCodon optimized for expression in human cellsPromoterCMVAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV12 [psng-1::SNG-1::CRY2olig(535)]
Plasmid#197596PurposePan-neuronal expression of SNG-1::CRY2olig(535) in neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN687
Plasmid#177363PurposeExpresses human KIF1A(1-393)(P305L) fused with leucine zipper and His tagDepositorInsertKIF1A (KIF1A Human)
TagsHis tag and Leucine zipperExpressionBacterialMutationchanged Proline 305 to LeucinePromoterT7Available SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Clover-Muro
Plasmid#82334PurposeVector targeting the Clover gene to the GAPDH locus of human cells. Clover is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertClover-T2AMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMeo
Plasmid#82502PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. G418 resistance is encoded by the Meo gene.DepositorInserteGFP-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
HDM_SARS2_Spike_del21_D614G
Plasmid#158762PurposeMammalian expression vector for expressing SARS-2 Spike with 21 aa del at C-terminus and pt mutation D to G at site 614DepositorInsertSARS2-Spike_del21_D614G (S Synthetic, Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationdeleted amino acids 1257-1278, changed aspartic a…PromoterCMVAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
KIF5A-GFP-SspB
Plasmid#214401PurposeExpresses fusion of Kinesin heavy chain 5A (1-572) with GFP and SspB (micro)DepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
cryS96
Plasmid#67519PurposeαB-crystallin minipeptide fused to ELP (S96).DepositorInsertmini-αB-crystallin fused to ELP S96 (VPGSG) (CRYAB Synthetic, Human)
Tagselastin-like polypeptide (ELP) S96ExpressionBacterialMutationmini-αB-crystallin contains residues 73–92 of aB-…PromoterT7Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Flag-Apex-Rab7A
Plasmid#135652PurposeRab7A fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
iLID-tdTomato-Omp25
Plasmid#214400PurposeExpresses fusion of iLID with tdTomato and transmembrane domain of Omp25DepositorInsertiLID-tdTomato-Omp25 (Synj2bp Rat, Synthetic)
TagsiLID-TdTomato-Omp25ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTFG002-ACE2(Mut)-HA
Plasmid#191570PurposeACE2 insert in a 2nd generation lentiviral transfer plasmid (pGIPZ) to generate ACE2(Mut)-expressing cells. Codon-optimized for human expression. Insert contains C-terminal HA Tag.DepositorInsertAngiotensin Converting Enzyme II (ACE2 Human)
UseLentiviral and RNAiTagsHA tagExpressionMammalianMutationCodon-optimized for human expression. Also contai…PromoterCMVAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
phH1-GBX2-gRNA
Plasmid#192510PurposeContains gRNA for GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
phU6-CDX4-gRNA
Plasmid#192511PurposeContains gRNA for CDX4DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmU6-CDX1-gRNA
Plasmid#192512PurposeContains gRNA for CDX1DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
ph7SK-CDX2-gRNA
Plasmid#192513PurposeContains gRNA for CDX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-TP1107(Q15TAG)
Plasmid#247462PurposeBacterial expression of anti-IgG VHH clone TP1107 with amber stop codon at Q15 for unnatural amino acid incorporationDepositorInsertTP1107 Q15TAG
TagsHis6 and TEV protease cleavage siteExpressionBacterialMutationOriginal Q15 codon (CAA) was modified to amber st…PromoterT7Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
HDM-SARS2-Spike-delta21
Plasmid#155130PurposeEncodes SARS-CoV-2 Spike with 21 aa C-terminal deletions for lentiviral pseudotypingDepositorInsertSARS-CoV-2 Spike-delta21 (S Severe acute respiratory syndrome coronavirus 2)
UseLentiviralExpressionMammalianMutationCodon optimized to H. sapiens using IDT codon opt…PromoterCMVAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/CD63mScarlet
Plasmid#182972PurposeStably express CD63 fused with mScarlet in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
Plasmid#210820PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)DepositorTagsMyc, 3xFlag and TwinStrep, 10xHisExpressionMammalianPromoterCMV and CMV / IRES2Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only