We narrowed to 1,586 results for: Tef
-
Plasmid#200883PurposeBacterial expression of N-terminal HiBIT-tagged human WDR5 proteinDepositorInsertHiBIT-WDR5 (WDR5 Human)
UseTagsExpressionBacterialMutationWTPromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTVL2-BIRC2-BIR3
Plasmid#196367Purposeprotein expression of the GST-tagged BIR3 domainDepositorInsertBIRC2 BIR3 domain
UseTagsHis6-GST-TEVExpressionBacterialMutationcontains only S260-Y352PromoterT7Available sinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[R272A,K276A, R280A,K284A]
Plasmid#188599PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler (Nbr Fly)
UseTagsFLAG-MycExpressionInsectMutationR272A [CGG=> GCG], K276A [AAG=>GCG], R280A …PromoterAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
UseTagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human USP7-3X FLAG
Plasmid#225334PurposeLentiviral expression of human USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human USP7_H456A-3X FLAG
Plasmid#225335PurposeLentiviral expression of human mutant USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationH456APromoterEF1aAvailable sinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_WT USP7
Plasmid#131242PurposeMammalian expression of N-terminally Myc-tagged USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationPromoterCMV enhancer + CMV promoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Linear Tau 0N4R 3X Flag tag
Plasmid#194171PurposeInsert contains linear tau 0N4R with a 3X Flag tag. Expresses linear protein tau 0N4R with a 3X Flag tag for Immunoprecipitation.DepositorInsertMicrotubule-Associated Protein Tau 0N4R
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
His-MBP human SPOP (aa 28-337)
Plasmid#52294Purposebacterial expression of human SPOP (aa 28-337) fused to His-MBPDepositorInsertSPOP (SPOP Human)
UseTagsHis-MBP and TEVExpressionBacterialMutationPromoterT7Available sinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
FRT_htr2c(c)-GFP
Plasmid#79677Purposeserotonin receptor minigene with consensus splice sites that expresses the full length serotonin receptor with a C-terminal EGFPDepositorInsertserotonin receptor 2C (HTR2C Human)
UseTagsEGFP in FrameExpressionMammalianMutationsplice site of exon Vb in consensusPromoterCMVAvailable sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB-USP7
Plasmid#99393PurposeMammalian expression construct for S protein-Flag-Streptavidin binding peptide (SFB)-tagged USP7DepositorInsertUSP7 (USP7 Human)
UseTagsSFB (S protein-FLAG-Streptavidin binding peptide)ExpressionMammalianMutationPromoterAvailable sinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc-ns
Plasmid#226719PurposePlasmid enabling yeast-mediated expression of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
UseTagsHA tagExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV14_NHP2L1(15.5kD)
Plasmid#73065Purposeexpression clone for human NHP2L1 (15.5kD) with C-terminal 3xFLAG-tagDepositorInsertNHP2L1 (15.5kD) (SNU13 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg
Plasmid#73073Purposehuman E2F7 minigene (exons 11,12,13/introns cassette)DepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterCMVAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-EXO1b D173A
Plasmid#68269PurposeBacterial expression of human EXO1 D173A (catalytically-dead) mutantDepositorInsertEXO1 (EXO1 Human)
UseTagsMxe intein/chitin binding domainExpressionBacterialMutationcatalytically-dead D173A. Please see depositor co…PromoterT7Available sinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-ATI_QconCAT_1
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
UseTagspolyhistidine tagExpressionBacterialMutationPromoterT7 promoterAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
UseTags3X flag tagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
UseTagsExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …PromoterAvailable sinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
Tau BA 12->10 N296N
Plasmid#203383PurposeFor transfection and in vitro assayDepositorInsertMAPT (MAPT Human)
UseTagsExpressionMammalianMutationN296N (silent mutation)PromoterCMVfAvailable sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
UseTags3x FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
UseTagsExpressionMammalianMutationChanged Valine 337 to MethinoninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_C223S USP7
Plasmid#131243PurposeMammalian expression of catalytically inactive Myc-tagged USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationContains a point mutation that converts USP7 cyst…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_haPD-1
Plasmid#226716PurposePlasmid enabling yeast-mediated expression and secretion of high affinity PD-1 microbody (haPD-1)DepositorInsertHigh affinity PD-1 microbody
UseTagsHA tag and Mating factor alpha secretion signalExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_rPD-L1nb
Plasmid#226717PurposePlasmid enabling yeast-mediated expression and secretion of recombinant PD-L1 nanobody (rPD-L1nb)DepositorInsertRecombinant PD-L1 nanobody
UseTagsHA tag, Histidine tag, and Mating factor alpha se…ExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
WT USP7 TRAF
Plasmid#227226PurposeExpresses human TRAF-like domain of USP7 with a N-terminal cleavable 6His tag in E. coliDepositorInsertUSP7 (Ubiquitin carboxyl-terminal hydrolase 7) (USP7 Human)
UseTags6HisExpressionBacterialMutationaa 62-205PromoterT7-promoterAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available sinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_884-1102 USP7
Plasmid#131249PurposeMammalian expression of the USP7 UBL4-5 domains with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationEncodes USP7 UBL domains 4-5 (USP7 amino acids 88…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_775-1102 USP7
Plasmid#131250PurposeMammalian expression of the USP7 UBL3-5 domains with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationEncodes USP7 UBL domains 3-5 (USP7 amino acids 77…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Human, Synthetic)
UseTagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA USP7
Plasmid#131252PurposeMammalian expression of N-terminally Myc-tagged DW164AA USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationContains a point mutation that converts USP7 aspa…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12V337M
Plasmid#194169PurposeInsert: intronic Tau authentic Alu and repeat elements. Introns are flanked by the tau cDNA exons 10-12 with FTLD-Tau V337M mutant. Expresses tau circular RNA 12-->10 VM with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
UseTags3X flagExpressionMammalianMutationChanged Valine 337 to MethinoninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_2ntmut
Plasmid#73067Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (E2F7 Human)
UseTagsno tagExpressionMammalianMutation2 nt mutation in AS box that binds E2F7 pre-mRNAPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_PP7-tag
Plasmid#73078Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-endDepositorInsertE2F7 (E2F7 Human)
UseTags5'-PP7-tag RNAExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_2ntmut
Plasmid#73074Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns, 2…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh1
Plasmid#235527PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh5
Plasmid#235528PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT USP7 UBL-12
Plasmid#227230PurposeExpresses human UBL-12 domain of USP7 with a N-terminal cleavable 6His tag in E. coliDepositorInsertUSP7 (Ubiquitin carboxyl-terminal hydrolase 7) (USP7 Human)
UseTags6HisExpressionBacterialMutationaa 535-775PromoterT7-promoterAvailable sinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
UseTagsHA tag and Mating factor alpha secretion signalExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12K317M
Plasmid#194168PurposeInsert: intronic Tau authentic Alu and repeat elements. Introns are flanked by the tau cDNA exons 10-12 with FTLD-Tau K317M mutant. Expresses tau circular RNA 12-->10 KM with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 K317M
UseTags3X FlagExpressionMammalianMutationChanged Lysine 317 to MethioninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_6ntmut
Plasmid#73075Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_10ntmut
Plasmid#73076Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPOP_WT
Plasmid#81856PurposeGateway Donor vector containing SPOP ,part of the Target Accelerator Plasmid Collection.DepositorInsertSPOP (SPOP Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationPromoterTRE-CMVAvailable sinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPOP_p.F133S
Plasmid#81637PurposeGateway Donor vector containing SPOP, part of the Target Accelerator Plasmid Collection.DepositorInsertSPOP (SPOP Human)
UseGateway entry vectorTagsExpressionMutationF133SPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_535-1102 USP7
Plasmid#131246PurposeMammalian expression of the five USP7 UBL domains with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationExpresses USP7 amino acids 535-1102. This truncat…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPOP_p.W131G
Plasmid#81632PurposeGateway Donor vector containing SPOP , part of the Target Accelerator Plasmid Collection.DepositorInsertSPOP (SPOP Human)
UseGateway entry vectorTagsExpressionMutationW131GPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only