We narrowed to 10,006 results for: Gnas
-
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
BACE2_pcDNA6.2/EmGFP-Bsd
Plasmid#176942PurposeMammalian expression vector encoding BACE2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-mCherry
Plasmid#135189PurposeExpresses TRPML1 with C-terminus mCherry tag in mammalian cells.DepositorAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut)
Plasmid#197892PurposeCan be used to generate AAV virus that will express hM4D/2A/GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInserthM4D/2A/GFP
UseAAVMutationN/APromoterEF1aAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgAAVS1
Plasmid#85802PurposeCas9/CRISPR vector for cut at human AAVS1 gene intron1DepositorInsertPPP1R12C (PPP1R12C Human)
ExpressionMammalianAvailable SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
ITSN-mcherry-sspB
Plasmid#85220PurposeRole of Cdc-42 selective GEF domain from ITSN in immune cell migrationDepositorInsertsTagsNAExpressionMammalianMutationR73QPromoterCMVAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TGFB1_pLX307
Plasmid#98377PurposeLentiviral expression of TGFB1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Sox2
Plasmid#101761PurposeSox2 promoter reporterDepositorAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-EBF1
Plasmid#96965PurposeDox-inducible expression of Ebf1 in mammalian cellsDepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertVillin-mTQ2-P2A-FlpO-ERT2
TagsmTQ2, linked to FlpO through an P2A ribosomal ski…ExpressionMammalianPromoterVillinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA
Plasmid#154867PurposeFlp-dependent hM4D(Gi) DREADD-mCherryDepositorHas ServiceAAV Retrograde and AAV8InserthM4D(Gi)-mCherry
UseAAV; Flp-frtTagsmCherryExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL403
Plasmid#119953PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-FLEX-[FGL-2A-palmRFP1]
Plasmid#190236PurposeAAV vector, high-level expression of somatodendritic-targeted EGFP (FGL) and membrane-targted mRFP1 (palmRFP1) in neuronal cells in the presence of Cre recombinaseDepositorInsertEGFP
UseAAVTagsF2A, LDLR C-terminal sequence, mRFP1, myristoylat…ExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYC_pLX307
Plasmid#98363PurposeLentiviral expression of MYCDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoTGFBRs
Plasmid#118942PurposeMammalian expression plasmid of OptoTGFBRs (optogenetically-activated TGFb receptors)DepositorTagstdTomatoExpressionMammalianPromoterCMVAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87829PurposeHigh-efficient mammalian expression vector for co-expression of BFP-, EGFP- and mCherry-tagged proteins using P2AT2A. MTS, NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsMTS
NLS
PTS1
ExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
NES-EGFP-PH-ARNO2G-I303Ex2
Plasmid#116868PurposePIP3 biosensorDepositorInsertCYTH2 (CYTH2 Human)
TagsEGFP and X.leavis map2k1.L(32-44)ExpressionMammalianMutationamind acids 252-399, isoleucine 303 changed to gl…Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
GABPA_pcDNA6.2/EmGFP-Bsd
Plasmid#176970PurposeMammalian expression vector encoding GABPA and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGolt-mCherry / pGolt3-mCherry
Plasmid#73297PurposeVisualization of Dendritic Golgi SatelliteDepositorInsertsER export signal of Scap
ER export signal of Scap
TMD (trans-membrane domain) of Calneuron-2 (Cabp7 Rat)
TagsER export and mCherryExpressionMammalianPromoterCMV immediate early promoterAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only