-
Plasmid#68210PurposeProvides a Short guide RNA which is the combination of the bacterial crRNA and tracrRNA into a single guide transcript; it does not contain any target siteDepositorInsertSgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-CXCR4(90)
Plasmid#98962PurposeMammalian expression plasmid for CRISPR gRNA targeting human CXCR4 exon 2DepositorInsertCXCR4 (CXCR4 Human)
UseCRISPRTagsExpressionMammalianMutationEncodes a gRNA for CRISPR-mediated targeting of C…PromoterU6Available sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPbuCas13b-gRNA-NT
Plasmid#184568PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PbuCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array witha nontargeting spacer for PbuCas13b in bacteria.
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119Available sinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-guideless
Plasmid#129464PurposeDerived from pSCB2-sgRNA. 20 nucleotide binding sequence of sgRNA removed by inverse PCR. Used as a negative control.DepositorInsertGuideless gRNA backbone
UseCRISPRTagsExpressionBacterialMutationPromoterBBa_J23119 (SpeI)Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA2
Plasmid#201591PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12
Plasmid#61079PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorInsertgRNA_hIRF1 promoter #12 (IRF1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_1
Plasmid#73533PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_2
Plasmid#73534PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoterpUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA AAVS1
Plasmid#128119PurposeCo-expresses sgRNA AAVS1, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA AAVS1 + GFP
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HK2_sgRNA2
Plasmid#201597PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHK2 (HK2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pgaC
Plasmid#154919PurposeaTc inducible gRNA targeting pgaC along with arabinose-inducible lambda red enzymesDepositorInsertgRNA targeting pgaC
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterpTetAvailable sinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only