We narrowed to 9,048 results for: sgRNA
-
Plasmid#92115PurposeExpression plasmid for human codon-optimized dead/inactive high-fidelity SpCas9-HF1 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9-HF1 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEC726
Plasmid#190814PurposeCRISPRi backbone plasmid harboring BbsI sites for easy cloning of sgRNA targeting regions via Golden gate.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyMutationS. pyogenes dCas9 codon optimized for Streptomyce…PromoterSP30Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_355
Plasmid#187159PurposeLentiviral expression of doxycycline inducible customizable Sp Cas9 sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGE687
Plasmid#167299PurposeVector for plant genome editing containing p35S:GFP-Cas9 expression cassette, nptII selection marker, and SlFAST2 and Ca-Bs3 counterselction markers, but not sgRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgTK
Plasmid#122852PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK geneDepositorInsertsCas9-GFP
U6-sgTK
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHYCUT
Plasmid#255426PurposeExpresses codon-optimized versions of SpCas9 and Csy4, with a U6 promoter-driven BsaI cloning casette for the expression of multiple sgRNAs in Phaeodactylum tricornutum.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Episomal vector for…Available SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR1068
Plasmid#111092PurposeBFP/puromycin marked gRNA vector. Contains sgRNA against GFP/BFP N-terminus.DepositorTypeEmpty backboneUseLentiviralMutationBlpI site disruptedAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
KL157 - pBlueScript II SK-Grb10_HA-T2A-eGFP-SV40PolyA
Plasmid#232935PurposeDonor plasmid for knock-in of T2A-eGFP-SV40pA at the mouse Grb10 locus. Used with PX459-sgRNA048_Grb10 sgRNA.DepositorInsertT2A-eGFP-SV40pA with Grb10 homology arms
UseMouse TargetingAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWRS_1001
Plasmid#192205Purposelentiviral expression of SpCas9 and two pol III promoters for dual expression of sgRNAsDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and RNAiAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
SPDK3902(TRV-RNA2-pPEBV-MCS-AtGly-tRNA)
Plasmid#149278PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtGly-tRNA mobile RNA sequence
UseT-dna vectorMutationT2318C (DNA) in PEBV coat protein sequenceAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-iT7
Plasmid#211699PurposeNIS-Seq-compatible lentiviral vector for expressing sgRNAsDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMonAID_dCas9-PmCDA_Hyg_ALS
Plasmid#91692PurposeMonocot Target-AID vector expressing rice-optimized dCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A and H840A for dead Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_T2A-Gal4vp16_synCoTC_4xnrUAS-mKate2
Plasmid#199481PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_T2A-Gal4vp16_synCoTC_4xnrUAS-mKate2
Plasmid#199482PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE792
Plasmid#167300PurposeVector for plant genome editing containing pRPS5a:GFP-Cas9 expression cassette, Bar (BASTA/PPT) selection marker, and FCY-UPP and Ca-Bs3 counterselction markers, but not sgRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only