We narrowed to 24,058 results for: crispr
-
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[S1Apt]
Plasmid#68425PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "S1" streptavidin aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct with S1 streptavidin aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pV1338
Plasmid#111443PurposeSolo vector pV1326 + sgScADE2DepositorInsertCaCas9/sgScADE2
UseCRISPRExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pJK520
Plasmid#155386PurposePphlF-TA1 crRNAs, 2x cascade. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
PphlF-TA1 in dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025)
Plasmid#140003PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpRY(D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpRY=A61R/L1111R/D1135L/S1136W/G121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
TETv4
Plasmid#167983PurposeExpresses TETv4 (TET1CD-XTEN80-dCas9-3xNLS-P2A-BFP) downstream of the CAG promoterDepositorInsertTETv4 (TET1CD-XTEN80-dCas9)
UseCRISPR and Synthetic BiologyTags3xNLS, TET1 catalytic domain, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE3 HEK3
Plasmid#206273PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE3 HEK3 prime editing.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC013 - Twinstrep-SUMO-huLwCas13a
Plasmid#90097PurposeTwinstrep-SUMO-huLwCas13a for recombinant protein bacterial expression. Insert is human codon optimized but expresses well in bacteria.DepositorInsertLwCas13a
UseCRISPRTags6xHis-Twin Strep-SUMOExpressionBacterialAvailable SinceJune 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax
Plasmid#187893PurposeAll-in-one prime editor piggyBac transposon with PEmaxDepositorInsertSpCas9_H840A_KK-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT/Cre
Plasmid#66895PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertsgNT
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLkb1/Cre
Plasmid#66894PurposeExpresses an Lkb1-targeting gRNA and Cre-recombinaseDepositorInsertsgLkb1
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pb-CAGGS-dCas9-VP64-blasto
Plasmid#218556PurposeEncodes CAG promoter-driven dCas9-VP64 with a bipartite SV40 NLS between dCas9 and VP64, along with blasticidin resistanceDepositorInsertdCas9
UseCRISPR; Piggybac transpositionTags2xSV40NLS-VP64ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only