We narrowed to 1,509 results for: U6 promoter
-
Plasmid#254582PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and eGFP from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralExpressionMammalianPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-[BsmBI_pegRNA_entry]-tevopreQ1-term (LM1138)
Plasmid#223137PurposepU6 entry plamid for cloning prime editor tevopreQ1 epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertetevopreQ1 entry plasmid backbone for epegRNA expression via human U6 promoter
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
Plasmid#117134PurposeAll-in-one expression vector for Cas9 and gRNA against CD44DepositorInsertgCD44 v2 (Cd44 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1, PolyU(0)
Plasmid#166992PurposeTests for the impact of a synthetic linear tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination module:PolyU(0)
ExpressionMammalianAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Nkx2-5
Plasmid#117137PurposeExpression vector encoding BFP-BSD-Nkx2-5DepositorInsertNkx2-5 CDS (Nkx2-5 Mouse)
UseLentiviralExpressionMammalianMutationmodified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL-U6-sgRNA-SFFV-Puro-P2A-EGFP
Plasmid#175037PurposeLentiviral delivery of sgRNA. Expresses PuroR and eGFP from SFFV promoter.DepositorInsertSp sgRNA scaffold
UseLentiviralPromoterU6Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS
Plasmid#129532PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIA4DepositorInsertscodon-optimized AcrIIA4
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 L1-R5
Plasmid#62113PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 R4-R3
Plasmid#62117PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 L5-L2
Plasmid#62115PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 L1-L4
Plasmid#62114PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 L5-L4
Plasmid#62116PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
Plasmid#210709PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation moduleDepositorInsertSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
UseAAV and CRISPRExpressionMammalianMutationN55K in MCPPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS/U6/RNAi gamma-tubulin shRNA mouse
Plasmid#70666PurposeReduced the expression of gamma-tubulin in murine cellsDepositorInsertUseU6 promoterExpressionMammalianPromoterU6Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L4
Plasmid#62138PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseGateway Cloning and RNAiExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-R5
Plasmid#62135PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseGateway Cloning and RNAiExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-L4
Plasmid#62136PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseGateway Cloning and RNAiExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA R4-R3
Plasmid#62137PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseGateway Cloning and RNAiExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L2
Plasmid#62139PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseGateway Cloning and RNAiExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-FnCas12a crRNA-BsmBI cassette (BPK4446)
Plasmid#114087PurposeU6 promoter crRNA entry vector used for all FnCas12a crRNAs (clone spacer oligos into BsmBI cassette)DepositorInsertentry vector for FnCas12a crRNAs
ExpressionMammalianAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-MbCas12a crRNA-BsmBI cassette (BPK4449)
Plasmid#114088PurposeU6 promoter crRNA entry vector used for all MbCas12a crRNAs (clone spacer oligos into BsmBI cassette)DepositorInsertentry vector for MbCas12a crRNAs
ExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2a_(CJT91)
Plasmid#226991PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2a must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No3
Plasmid#194898PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-3 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.3
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No9
Plasmid#194903PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-9 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.9
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No4
Plasmid#194899PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-4 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.4
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only