We narrowed to 8,846 results for: FIE
-
Plasmid#195552PurposeExpresses Thbs1 under control of short GFAP promoterDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only
-
FLAG-MED22
Plasmid#15423DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)DsRed
Plasmid#200114PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF.GFP
Plasmid#17616DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+mEGFP-H1.4
Plasmid#157799PurposeExpression of mEGFP and human linker histone H1.4 fusion proteinDepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pV1210
Plasmid#242891PurposeModified plasmid from pV1200 to perform ENO1-SI CRISPR in Candidozyma aurisDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)dTomato
Plasmid#200113PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-RFP
Plasmid#1817PurposeMammalian expression of Lamp1 fused to RFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsRFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-KFERQ-NE
Plasmid#102365PurposeLentiviral overexpression of PA-mCherry-KFERQ fusionDepositorInsertsPA-mCherry
KFERQ peptide
UseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNatA (pACYCduet-naa10-naa15)
Plasmid#72928PurposeAllows expression of a modified version of the fission yeast NatA complex - chloramphenicol markerDepositorExpressionBacterialMutationCodon optomised for E.coli expressionPromoterT7Available SinceFeb. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FAM20C:V5
Plasmid#63584PurposeFAM20C can phosphorylate secreted phosphoproteins, and characterization of its activity identifies FAM20C as a Golgi casein kinase.DepositorAvailable SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB117 - pL2_pSB90_fLUC-I_V2
Plasmid#123192Purposebinary plant vector for transient TYLCV V2 and fLUC (with intron) expressionDepositorInsert2x35S::V2::tNOS 2x35S::fLUC-I::tNOS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-Cre
Plasmid#196140PurposeAAV-mediated expression of Cre under the CAG promoter .DepositorInsertCre
UseAAVExpressionMammalianMutationcodon diversifiedPromoterCAGAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-mDia1(FH1FH2DAD)-His
Plasmid#85822Purposecontains the formin homolgy domains: FH2 is required for nucleation, processive tracking of barbed-end of actin filaments ; FH1 permits enhancement of actin polymerization rate.DepositorInsertProtein diaphanous homolog 1 (Diaph1 Mouse)
Tags8*His and GSTExpressionBacterialPromotertacAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pH-ABE8e
Plasmid#200774PurposeFor plant adenine base editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(D10A)-TadA8e
UseCRISPRExpressionPlantMutationD10A for Cas9; W23R, H36L, P48A, R51L, L84F, A106…Promotermaize Ubiquitin-1, OsU3Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL357
Plasmid#243711PurposeA piggyBac vector containing the COX7A2 coding sequences, modified with silent mutations to allow for PCR-based analysis, along with endogenous promoter and UTRs.DepositorAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only