We narrowed to 9,878 results for: CAG
-
Plasmid#87693PurposeExpress ERT2-PhoCl-Gal4VP16-PhoCl-ERT2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertERT2-PhoCl-Gal4VP16-PhoCl-ERT2
ExpressionMammalianAvailable sinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHLmMBP-10
Plasmid#72348PurposeMammalian expression of secreted N-terminally 8His-tagged mMBP TEV cleavage site-linked fusion proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneTags6His-tag, 8His-tag, HA-tag, Strep-tag II, and mMB…ExpressionMammalianPromoterCMV enhancer + chicken beta-actin promoterAvailable sinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable sinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-SAM
Plasmid#102559PurposePiggybac transposon vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsMS2-P65-HSF1_T2A_Hygro
dCAS9(D10A, N863A)-VP64_T2A_Blast
UseCRISPR; Piggybac transposonExpressionMammalianMutationD10A and N863A in Cas9 and N55K in MS2PromoterCAG and EF1AAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKS004 - pCAGGS-3XFLAG-CTCF-eGFP
Plasmid#156438PurposeFor transient expression of mouse CTCF tagged with eGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmouse CTCF (Ctcf Mouse)
ExpressionMammalianMutationnoneAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAFNF-DsRed
Plasmid#13771PurposeFlp recombinase-dependent expression of DsRed, i.e. DsRed is only expressed in the presence of Flp due to a transcriptional stop in between the FRT sites.DepositorInsertDsRed2
UseFlp/frtExpressionMammalianPromoterCAGAvailable sinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TK4-EGFP
Plasmid#239047PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR
ExpressionMammalianPromoterCAG and EF1aAvailable sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-oNGN2
Plasmid#198397PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression. oNGN2 is a Phospho-mutant which avoids inhibition by cdk kinase, NGN2 optimization aided by IDT tool.InsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationS24A, S193A, S207A, S209A, S219A, S232A, S239A, S…PromoterCAG, EF1a, and TRE3GAvailable sinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-FLEX-ArchT-GFP
Plasmid#28307PurposeCre-dependent viral expression of ArchT-GFP for neuronal inhibitionDepositorInsertArchT-GFP
UseAAV and Cre/Lox; Adeno-associated virusTagsGFPExpressionMammalianMutationN/APromoterCAGAvailable sinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-CAG-NLS-dCas9-HA-2XNLS-10xGCN4-NLS-P2A-scFv-NLS-P65-HSF1-Flag-WPRE-PolyA-PGK-EM7-NeoR-polyA
Plasmid#168290PurposeCRISPR-activator Suntag-P65-HSF1 (SPH)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9, Suntag-P65-HSF1
ExpressionMammalianPromoterCAGAvailable sinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-mRuby3-WPRE
Plasmid#99279PurposeCan be used to generate AAV virus that will express mRuby3 in the presence of CreDepositorInsertmRuby3
UseAAV and Cre/LoxAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP/RFP-miR-Scrint
Plasmid#19821DepositorInsertScrambled miRNA
UseCre/Lox and RNAiExpressionMammalianAvailable sinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCS-DsRed
Plasmid#164091Purposeexpression of DsRed-tagged proteins under CAG promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDsRed
TagsDsRedExpressionMammalianPromoterCAGAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENN236_CRISPRcharm_Kv2
Plasmid#220839PurposeCRISPRcharm Kv2 expression in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPRcharm Kv2
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterCAGAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PC-GCaMP6f
Plasmid#73503PurposeGCaMP6f knock in construct into the AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGCaMP6f
ExpressionMammalianPromoterCAGAvailable sinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAGGS SARS-CoV-2 BA.2.12.1 Spike
Plasmid#186032PurposeExpresses codon-optimized full length SARS-CoV-2 BA.2.12.1 SpikeDepositorInsertSARS-CoV-2 BA.2.12.1 Spike (S )
ExpressionMammalianMutationContains the BA.2 mutations (T19I, LPPA24S, G142D…Promoterchicken β-actin promoter, CMV enhancerAvailable sinceJune 8, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAVS1-Neo-CAG-M2rtTA-H2BmNeon (donorAB-mNeon)
Plasmid#85799PurposedonorAB-Neon targeting vector for human AAVS1 locus; knock-in of Dox controlled H2BGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPPP1R12C (PPP1R12C Human)
UseHuman targetingMutationhomology arms for knock-in into first intronAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-dCas9-KRAB
Plasmid#115545PurposeDoxycycline inducible dCas9-KRAB targeting construct for AAVS1 locusDepositorTypeEmpty backboneTagsHAExpressionBacterial and MammalianPromoterCAGAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CBh-mKate2-IRES-MCS (WT-WT)
Plasmid#105921PurposeAAV-mediated gene expression from CBh promoter. Contains canonical left and right AAV2 ITRsDepositorHas serviceAAV2InsertsmKate2
IRES-Multiple cloning site
UseAAVMutationcodon optimizedPromoterCBh and same CBh promoter as mKate2Available sinceFeb. 15, 2018AvailabilityIndustry, Academic Institutions, and NonprofitsCited by