We narrowed to 35,146 results for: LAT

#143100

Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.

Feng Zhang

Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi

June 27, 2023

Academic Institutions and Nonprofits only

#174823

Mammalian expression of human MLH1dn (original codon usage)

David Liu

Chen et al Cell. 2021 Oct 28;184(22):5635-5652.e29.

Dec. 14, 2021

Academic Institutions and Nonprofits only

#162774

Soluble human PACE/furin protease expression

Ivan Vorobiev

Kovnir et al Acta Naturae. 2018 Jan-Mar;10(1):51-65.

July 23, 2021

Academic Institutions and Nonprofits only

#125174

Expresses human EED in insect cells, under a TEV-cleavable N-terminal polyhistidine tag.

Chen Davidovich

Zhang et al Nat Struct Mol Biol. 2019 Mar;26(3):237-

May 1, 2020

Academic Institutions and Nonprofits only

#120167

Expresses a chimera of mCherry (fluorescent tag), a KIF17-based anterograde motor and streptavidin

Juan Bonifacino

Guardia et al PLoS Biol. 2019 May 17;17(5):e3000279. d

July 30, 2019

Academic Institutions and Nonprofits only

#112710

Expresses N-terminally His-tagged human CE/RNGTT in bacterial cells

Daniel Schoenberg

Trotman et al Nucleic Acids Res. 2017 Oct 13;45(18):10

Aug. 21, 2018

Academic Institutions and Nonprofits only

#110318

Control (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Aug. 13, 2018

Academic Institutions and Nonprofits only

#100734

To express a clathrin "hook" in mammalian cells to hot-wire endocytosis

Stephen Royle

Wood et al J Cell Biol. 2017 Sep 27. pii: jcb.20170

Sept. 26, 2017

Academic Institutions and Nonprofits only

#100730

To express a clathrin "hook" in mammalian cells to hot-wire endocytosis

Stephen Royle

Wood et al J Cell Biol. 2017 Sep 27. pii: jcb.20170

Sept. 18, 2017

Academic Institutions and Nonprofits only

#89749

Expression of light-regulated p38 inhibitor, Ypet-fused, wild-type photosensor, inhibitor MK3BD3-13F

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only

#98169

slow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with blue light, inactivation max with 580 nm (accelarates closure to ms). Codon optimized for mammalian expression.

Peter Hegemann

Wietek et al Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.

July 14, 2017

Academic Institutions and Nonprofits only

#73435

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 3, 2016

Academic Institutions and Nonprofits only

#156140

For use in RBP tethering screen

Eugene Yeo

Luo et al Nat Struct Mol Biol. 2020 Oct;27(10):989

Sept. 7, 2023

Academic Institutions and Nonprofits only

#155382

dCas12a (D917A) + PA4-mVenus. (removed crRNAs)

Pamela Silver

Kuo et al Nucleic Acids Res. 2020 Aug 20;48(14):81

Jan. 14, 2021

Academic Institutions and Nonprofits only

#155538

For use in RBP tethering screen

Eugene Yeo

Luo et al Nat Struct Mol Biol. 2020 Oct;27(10):989

Nov. 4, 2022

Academic Institutions and Nonprofits only