We narrowed to 522 results for: lenti crispr v2
-
Plasmid#189747PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA1
Plasmid#189746PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
SiC-V2-Cas9G7
Plasmid#133043PurposeDoxycycline-inducible SiC-V2 vector with Cas9G7 (sgRNA 7 targeting SpCas9 gene). In cells coexpressing Cas9 nuclease, this construct causes self-inactivation/editing of SpCas9 gene upon Dox addition.DepositorInsertTet repressor
UseLentiviralTagsCeruleanAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-puro-v2
Plasmid#127458PurposeEntry plasmid for guide cloningDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_mCherry
Plasmid#229078PurposeSmall lentiviral backbone for CRISPR guide libraries, improved titre for hard to transduce cellsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterEF1sAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.v2.TetON_Cas13d_U6_DR
Plasmid#196727PurposeSortable and selectable, Tet-inducible RfxCas13d with guide cassette (one vector system). Inducible knock-down.DepositorInsertRfxCas13d-T2A-miRFP670nano
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterTREAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2R
Plasmid#167932PurposelentiCRISPRv2 variant with mScarlet-I fluorescence marker.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Opti
Plasmid#163126PurposeLentiCRISPRv2 variant with modified sgRNA scaffold from Chen et al. 2013 Cell.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Blast-mU6
Plasmid#206806PurposepLentiCRISPRv2 variant with mU6 promoter driving the sgRNA, and a Blasticidin resistance cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenticrispr-wt-ltr-puro
Plasmid#173428PurposeExpresses Cas9 and guide RNA, contains intact LTRDepositorInsertS. pyogenes sgRNA cassette
UseLentiviralExpressionMammalianAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_hMSH2
Plasmid#186155PurposesgRNA targeting human MSH2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Beclin1
Plasmid#99574PurposeExpressed Cas9 with sgRNA targeting Beclin1DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-E
Plasmid#78852PurposeIntroduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsCas9-P2A-PuroExpressionMammalianAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p8391 LentiCRISPRv2 Neo sgPTPN14-1
Plasmid#221651PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-1 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8392 LentiCRISPRv2 Neo sgPTPN14-3
Plasmid#221652PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-3 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only