-
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGES401
Plasmid#190198PurposeFor CRISPR-Cas9 mediated multiple gene editing in soybean, single transcript unit system driven by soybean elongation factor 1A promoter (pM4), Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorInsertsgRNA targeting CRBN (CRBN Human)
UseLentiviral; CrisprTagsExpressionMammalianMutationPromoterU6Available sinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorInsertsgRNA targeting CRBN (CRBN Human)
UseLentiviral; CrisprTagsExpressionMammalianMutationPromoterU6Available sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE2
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorInsertHF2-BE2
UseTagsExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE3
Plasmid#120397PurposeExpresses HF2-BE3 in mammalian cellsDepositorInsertHF2-BE3
UseTagsExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Mouse, Synthetic)
UseLentiviralTagsNLS-HAExpressionMammalianMutationPromoterhuman ubiquitin C promoterAvailable sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorInsertRXRB gRNA (RXRB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_2
Plasmid#104051PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorInsertRXRB gRNA (RXRB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
UseTagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationPromoterCMVAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0041
Plasmid#117608PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SpCas9-h(pICSL11023) and sgRNA_RPS4A family protein {AT5G58420 }(pEPOR1CB0071)DepositorInsert[35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
UseTagsExpressionPlantMutationPromoterAvailable sinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B1
Plasmid#172842PurposeCRISPIE donor B1 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B8
Plasmid#172849PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B8 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 1-1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B9
Plasmid#172850PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B9 (Zhong et al, eLife 2021), mEGFP translational phase (2-2), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-2) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B5
Plasmid#172846PurposeCRISPIE donor B5 (Zhong et al, eLife 2021), CDS of VCL exon21-mEGFP, translational phase (0-stop), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-stop) encoding the CDS of VCL exon 21 fused to mEGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B10
Plasmid#172851PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B10 (Zhong et al, eLife 2021), mEGFP translational phase (2-stop), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-stop) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-GFP
Plasmid#222996PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-EGFP markerDepositorInsertPE7-P2A-EGFP
UseTagsP2A-EGFP, SV40 bpNLS, and c-Myc NLSExpressionMammalianMutationPromoterCMVAvailable sinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-BSD
Plasmid#224122PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-BSD markerDepositorInsertPE7-P2A-BSD
UseTagsP2A-BSD, SV40 bpNLS, and c-Myc NLSExpressionMammalianMutationPromoterCMVAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-mutant (Q20A_Y23A_Y24F_F35A)
Plasmid#224123PurposeMammalian expression of SpCas9 PE7 mutant prime editor (Q20A_Y23A_Y24F_F35A)DepositorInsertPE7-mutant (Q20A_Y23A_Y24F_F35A)
UseTagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationQ20A_Y23A_Y24F_F35A in La(SSB)1-194PromoterCMVAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
RED
Plasmid#139835PurposeExpresses RNase H1-EGFP- dCas9 fusion protein in human cellsDepositorInsertRNase H1-EGFP-dCas9 (RNASEH1 RNase H1 (H. sapiens), dCas9 (S. pyogenes))
UseTagsExpressionMammalianMutationdCas9 protein contains two mutations: D10A and H8…Promotertet-inducible CMVAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
dRED
Plasmid#139836PurposeExpresses dRNase H1-EGFP-dCas9 fusion protein in human cellsDepositorInsertdRNase H1-EGFP-dCas9 (RNASEH1 dRNase H1 (H. sapiens), dCas9 (S. pyogenes))
UseTagsExpressionMammalianMutationRNase H1 protein contains D210N mutation. dCas9 …Promotertet-inducible CMVAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorInserthuman AMPK alpha 1 exon1 gRNA (PRKAA1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorInserthuman AMPK alpha 1 exon1 gRNA (PRKAA1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDU1
Plasmid#169817PurposepSpCas9(BB)-2A-tCD19 (pDU1)DepositorInserttCD19
UseTagsfusion proteinExpressionMammalianMutationPromoterCbhAvailable sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-hMLH1dn
Plasmid#222997PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-human MLH1dn (codon optimized)DepositorInsertPE7-P2A-hMLH1dn
UseTagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDeletion of residues 754-756 in MLH1 as described…PromoterCMVAvailable sinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-PE7 for IVT
Plasmid#214813PurposeTemplate for in vitro transcription of PE7DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSExpressionMutationPromoterT7 (inactivated)Available sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_PE7_IVT_Template
Plasmid#223022PurposeTemplate for in vitro transcription of PE7. For HSPC-related experiments.DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSExpressionMutationPromoterT7Available sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PEmax_AAVS1_knockin_HDR_donor
Plasmid#223000PurposeHDR donor plasmid for PEmax knockin at AAVS1 locus. Left_homology_arm-splicing_acceptor-T2A-NeoR-bGHpA-pEF1α-PEmax-IRES2-EGFP-WPRE-βglobinpA-right_homology_armDepositorInsertPEmax
UseHdr donorTagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationPromoterEF1αAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorInserthuman AMPK alpha 2 exon1 gRNA (PRKAA2 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_B
Plasmid#74377PurposegRNA_B to knockout human AMPK alpha 2 using Cas9nDepositorInserthuman AMPK alpha 2 exon1 gRNA (PRKAA2 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
PE7_AAVS1_knockin_HDR_donor
Plasmid#223001PurposeHDR donor plasmid for PE7 knockin at AAVS1 locus. Left_homology_arm-splicing_acceptor-T2A-NeoR-bGHpA-pEF1α-PE7-IRES2-EGFP-WPRE-βglobinpA-right_homology_armDepositorInsertPE7
UseHdr donorTagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationPromoterEF1αAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-PE2-His (IK1822)
Plasmid#170103PurposeT7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLSDepositorInsertbpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
UseCRISPRTags6xHis tagExpressionBacterialMutationBacteria codon-optimized nSpCas9 (H840A) & M-…PromoterT7Available sinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-AsCpf1-Blast
Plasmid#84750PurposeExpresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone.DepositorInsertAsCpf1
UseCRISPR and LentiviralTagsNLS-3xHA (C terminal on insert)ExpressionMammalianMutationPromoterEFS-NSAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LbCpf1-Blast
Plasmid#84751PurposeExpresses human codon-optimized LbCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone.DepositorInsertLbCpf1
UseCRISPR and LentiviralTagsNLS-3xHA (C terminal on insert)ExpressionMammalianMutationPromoterEFS-NSAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-RfxCas13d-His
Plasmid#141322PurposePlasmid for bacterial expression and purification of RfxCas13d proteinDepositorInsertRfx-Cas13d
UseCRISPRTags6xHisExpressionBacterialMutationPromoterT7Available sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -