We narrowed to 289 results for: h cas9 protein
-
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-miniSdd7-BE4max-BlastR
Plasmid#204851PurposeFor cytosine base editing using miniSdd7 in mammalian cellsDepositorInsertminiSdd7-nSpCas9(D10A)-UGI
UseCRISPRExpressionMammalianMutationD10A in SpCas9PromoterCMV, SV40, EM7Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-miniSdd6-BE4max-BlastR
Plasmid#204850PurposeFor cytosine base editing using miniSdd6 in mammalian cellsDepositorInsertminiSdd6-nSpCas9(D10A)-UGI
UseCRISPRExpressionMammalianMutationD10A in SpCas9PromoterCMV, SV40, EM7Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-miniSdd3-BE4max-BlastR
Plasmid#204849PurposeFor cytosine base editing using miniSdd3 in mammalian cellsDepositorInsertminiSdd3-nSpCas9(D10A)-UGI
UseCRISPRExpressionMammalianMutationD10A in SpCas9PromoterCMV, SV40, EM7Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-SaKKH-spA-miniU6-miniSdd6-MmHPD-T2
Plasmid#204852PurposeAAV vector for cytosine base editing using miniSdd6 at HPD-T2 target site in mouseDepositorInsertminiSdd6-nSaCas9KKH(D10A)-UGI
UseAAV and CRISPRMutationD10A, E782K, N968K, R1015H in SaCas9PromoterEFS, miniU6Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xAARE-minP-EGFP
Plasmid#159666PurposeEGFP reporter plasmid containing 25 tandem repeats of the amino acid response element (AARE)DepositorInsert25xAARE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xERSE2-minP-EGFP
Plasmid#159667PurposeEGFP reporter plasmid containing 25 tandem repeats of the ER stress response element-2 (ERSE2)DepositorInsert25xERSE2-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA2
Plasmid#134637Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA2 (UFSP2 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA1 (UFSP2 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-KRAB
Plasmid#126589PurposeExpresses MCP (MS2 Coat Protein) fusion to KRAB in mammalian cells, lentiviral backboneDepositorInsert2XMCP-KRAB
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA2
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA2 (UFL1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA1
Plasmid#134635Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA1 (UFL1 Human)
ExpressionMammalianAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTB107-Phleo
Plasmid#236782PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the H. sapiens RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorInsertMiniCAFE
UseCRISPRMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3AL_bGHpA
Plasmid#177347PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGES401
Plasmid#190198PurposeFor CRISPR-Cas9 mediated multiple gene editing in soybean, single transcript unit system driven by soybean elongation factor 1A promoter (pM4), Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE2
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorInsertHF2-BE2
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE3
Plasmid#120397PurposeExpresses HF2-BE3 in mammalian cellsDepositorInsertHF2-BE3
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Mouse, Synthetic)
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_2
Plasmid#104051PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0041
Plasmid#117608PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SpCas9-h(pICSL11023) and sgRNA_RPS4A family protein {AT5G58420 }(pEPOR1CB0071)DepositorInsert[35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B1
Plasmid#172842PurposeCRISPIE donor B1 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS1625
Plasmid#239834PurposeOrufIscB-REC E. coli expression for recombinant purificationDepositorInsertOrufIscB-REC
Tags14xHis-TwinStrep-bdSUMOExpressionBacterialMutationInsertion of REC domain from NbaCas9-1PromoterT7Available SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only