We narrowed to 24,948 results for: Spr
-
Plasmid#209075PurposeTargeting vector for the human PRF1 locus to replace exon 3 with repaired exon 3DepositorInsertPRF1-Exon3 HDRT (PRF1 Human)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211693PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211696PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211695PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-3_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211698PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211697PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211689PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211690PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211691PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF827-sgNT-2_U6-sgRNA-EFS-Cas9-P2A-mNeonGreen
Plasmid#211694PurposeU6-sgRNA-EFS-Cas9-P2A-mNeonGreenDepositorInsertSpyCas9 and sgNT-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK880-pCAG-DmrC-NLS-3xFLAG-VP64
Plasmid#136912PurposeDmrC with VP64 fused to it's C-terminus; Mammalian expression vectorDepositorInsertpCAG-DmrC-NLS-3xFLAG-VP64
UseCRISPRExpressionMammalianPromoterChicken Beta ActinAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJGL003
Plasmid#180607PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-DpbCasX+Region3 insertionDepositorInsertDpbCasX with R3 loop
UseCRISPRTags10x His and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-RanCas13b-msfGFP-NES-Flag
Plasmid#165073Purposeoverexpression of RanCas13b in human cellsDepositorInsertRanCas13b
UseLentiviralExpressionMammalianAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only