We narrowed to 24,184 results for: CRISPR
-
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-36XMYC array
Plasmid#236380PurposeExpression of array of 36 crRNAs targeting MYCDepositorInsert36xMYC crRNA array (MYC Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; gcry1:BFP -0
Plasmid#173886PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; gcry1: BFP
UseSynthetic BiologyAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7501 pHR (hU6-crNT-EFS-PuroR-WPRE)
Plasmid#214876PurposeLentiviral vector encoding RfxCas13d nontargeting control guideDepositorInserthU6-crNT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huLbCpf1
Plasmid#90096PurposeBacterial expression plasmid for protein purificationDepositorInserthuLbCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-LAMP1
Plasmid#207788PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the LAMP1 locus. For lysosome visualization.To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a moxGFP-Puro Cassette (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-GOLGA2
Plasmid#207792PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the GOLGA2 locus for Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 Addgene #207791DepositorInsertGOLGA2 Homology Arms flanking a Puro-moxGFP Cassette (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Puro_siKO
Plasmid#86696PurposeTetracycline inducible expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 TOAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a-ZIM3-Cas9-P2A-GFP-PGK-Blasti
Plasmid#239610PurposeConstitutive active CRISPRgenee construct with a blasticidin resistanceDepositorInsertZIM3 KRAB domain (ZIM3 )
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1)-EF1a-Thy1.1-P2A-Neo
Plasmid#239608PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and H1 promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1-filler
UseCRISPR and LentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -