We narrowed to 6,964 results for: GFP expression plasmids
-
Plasmid#21921DepositorInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA
Plasmid#51110PurposeForebrain principal neuron expression of eArchT3,0 with physically uncoupled EGFP fluorophoreDepositorInserteArchT3.0
UseAAVTagsP2A-EGFPExpressionMammalianPromoterCaMKIIaAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-EGFP-WPRE-pA
Plasmid#37084PurposeCre-dependent expression of EGFPDepositorInsertEGFP
UseAAV and Cre/Lox; Cre-onPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP224-AAV-Basic-0.4αCaMKII-GFP-pA
Plasmid#62909PurposeAAV basic vector backbone designed to express GFP from a 0.4CaMKIIa promoter. It also contains a poly-Adenylation Signal (pA).DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.4αCaMKIIAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-Y705F-STAT3
Plasmid#71445PurposeRetroviral expression of Y705F-STAT3. Please note that this plasmid contains Y705F-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-GFP(39TAG)
Plasmid#217360PurposeExpression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmidDepositorInsertEnhanced green fluorescent protein
UseBaculoviralExpressionInsect and MammalianMutationY39TAGPromoterCMVAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD8a-cNLS-EGFP
Plasmid#86052PurposeA mammalian expression plasmid expressing CD8a luminal and transmembrane domains followed by cNLS (classical nuclear localization signal) and C-terminus EGFP.DepositorInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianMutationCD8a luminal and transmembrane along with two SV4…PromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Cre
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p110
Plasmid#117928PurposeADAR1-p110 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-GFP
Plasmid#58976Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-GFP
Plasmid#118286PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Poly(A)
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-GFP
Plasmid#118284PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK4-2A-GFP
Plasmid#118288PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and EGFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(KRHWMR)-P2A-EGFP_(RAS3808)
Plasmid#228251PurposepCMV human expression plasmid for SpCas9 enzyme with KRHWMR amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(KRHWMR)-P2A-EGFP
TagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(ARGIMR)=D1135K, S1136R, G1218H, E1219W, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLeAPS-GFP-blast
Plasmid#182230PurposeLentiviral transfer plasmid for the LeAPS packaging system; encodes GFP-P2A-blasticidin transgeneDepositorInsertGFP-P2A-Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-RPA70
Plasmid#164231Purposeretroviral plasmid for GFP-RPA70DepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst44-GFP
Plasmid#172310PurposeSST interneuron-restricted gene regulatory element GRE44, to drive GFP expression in SST+ interneuronsDepositorInsertSst44
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-vox-EGFP
Plasmid#79970Purposemammalian GFP reporter plasmid, target site for Vika recombinaseDepositorInsert2 vox-sites flanking neo in frame with EGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only