We narrowed to 14,983 results for: GRN
-
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-Puro-shPP2A-Abeta
Plasmid#15250DepositorInsertPP2A regulatory subunit A, beta isoform (PPP2R1B Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKD2.RNAi
Plasmid#10816DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pS448∙CsR
Plasmid#122096PurposeCRISPR/Cas9 counterselection in Gram-negative bacteriaDepositorInsertsCas9
sgRNA
UseSynthetic BiologyExpressionBacterialPromoterPem7 and PmAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFREE_Cm
Plasmid#92052PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.DepositorInsertsCas9
gRNA array
UseCRISPRPromoterpRhamBAD and ptetAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
shHIF2α(#2) (HIF2α-#3-pSUPER-retro-GFP/Neo)
Plasmid#22132DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceFeb. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pME-Cas9
Plasmid#64237Purposeexpresses codon optimized Cas9 in zebrafishDepositorInsertcodon optimized Cas9
UseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS403-PGAL1-hpSC_URA3
Plasmid#22317DepositorInsertURA hairpin
UseIntegrating plasmidExpressionYeastAvailable SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGIPz-PD-L1 WT
Plasmid#121486Purpose2nd generation lentiviral vector for over expressing human PD-L1 WT with PD-L1 shRNADepositorInsertPD-L1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2203
Plasmid#91066PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_C2200), Terminator: none - to be fused to gRNA array in MODULE CDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterCmYLCVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet2
Plasmid#85743PurposeshRNA against mouse Tet2DepositorInsertshRNA Tet2
UseAAVTagsEYFPAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGW03 AAV-TBG-Cre-sgRNA
Plasmid#192163PurposeAAV-TBG-Cre-sgRNADepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-SaCas9-pU6-sgRNA
Plasmid#159173PurposeVector A encodes pAAV-pMecp2-SaCas9-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of SaCas9-sgRNA in neuronsDepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-sgRNA-Tetra-com vector
Plasmid#131227PurposeFor expressing gRNA, whose Tetraloop is replaced with a com aptamerDepositorInsertvector for com modified sgRNA
UseAAVExpressionMammalianAvailable SinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
VVT1
Plasmid#65779PurposeThe Joung Lab recommends using BPK2660 (Addgene plasmid 70709) instead of VVT1 as guide RNAs cloned into BPK2660 are more effective than this plasmid. Human expression plasmid for S. aureus Cas9 sgRNADepositorInsertSaCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH051
Plasmid#171625Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA (no spacer, BsmBI cutsites) and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-BsmBI-Destination
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only