We narrowed to 426 results for: AAVS1
-
Plasmid#159298PurposeZFN (right) targeting the AAVS1 locus with obligate heterodimer FokIDepositorInsertZFN targeting the AAVS1 locus
ExpressionMammalianPromoterCMV promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE2-Hygro
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-P-CAG-GFPluc2
Plasmid#80493Purposedonor vector for AAVS1 targeting (puromycin selection) and constitutive GFP-luciferase fusion protein expressionDepositorInsertGFPluc2
UseDonor vector (human)ExpressionMammalianPromoterCAGAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-Sec61B
Plasmid#207553PurposeHomologous recombination donor to integrate and expression cassette for EGFP-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-Sec61B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Tet-OsTIR1(WT)-V5
Plasmid#158663PurposeTet-OsTIR1(WT)-V5 donor for integration at the AAVS1 locusDepositorInsertTet-OsTIR1(WT) AAVS1
UseCRISPRExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-35:AAVS1-mEGFP
Plasmid#91565PurposeHomology arms and linker-mEGFP sequence for internal insertion of CAGGS-mEGFP at the AAVS1 safe harbor location in human cells as a reporter for cytoplasmic mEGFPDepositorInsertAAVS1 Homology Arms with CAGGS driven mEGFP (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterCAGAvailable SinceJune 7, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2
Plasmid#192828PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmCherry
Plasmid#192827PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AAVS1-TALEN-L
Plasmid#159299PurposeTALEN (left) targeting the AAVS1 locus with obligate heterodimer FokIDepositorInsertTALEN targeting the AAVS1
UseTALENExpressionMammalianPromoterCMV promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AAVS1-TALEN-R
Plasmid#159300PurposeTALEN (right) targeting the AAVS1 locus with obligate heterodimer FokIDepositorInsertTALEN targeting the AAVS1
UseTALENExpressionMammalianPromoterCMV promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODAL
Plasmid#115638PurposeFor targeted integration and inducible expression of human NODAL using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-AAVS1-sg
Plasmid#194716PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hAAVS1 locusDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-CAG-AAVS1
Plasmid#115262PurposeFor stable integration and expression (under control of the CAG promoter) of a human NODAL splice variant from the AAVS1 safe harbour locus in human cellsDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_118
Plasmid#213167PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_118
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNM220_AAVS1 integration helper
Plasmid#211864PurposeCas9 cutting at AAVS1 safe harbor locusDepositorInsertAAVS1
UseCRISPRMutationN/AAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 SNAP-Sec61B
Plasmid#207580PurposeHomologous recombination donor to integrate and expression cassette for SNAPtag-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible SNAPTag-Sec61B
TagsSNAPTAGExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only