We narrowed to 409 results for: AAVS1
-
Plasmid#159299PurposeTALEN (left) targeting the AAVS1 locus with obligate heterodimer FokIDepositorInsertTALEN targeting the AAVS1
UseTALENTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AAVS1-TALEN-R
Plasmid#159300PurposeTALEN (right) targeting the AAVS1 locus with obligate heterodimer FokIDepositorInsertTALEN targeting the AAVS1
UseTALENTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODAL
Plasmid#115638PurposeFor targeted integration and inducible expression of human NODAL using doxycyclineDepositorInsertNODAL (NODAL Human)
UseTagsExpressionMammalianMutationPromoterTRE3GAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorInsertAAVS1 sgRNA spacer (AAVS1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
UseTagsExpressionMammalianMutationPromoterTRE-tightAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-AAVS1-sg
Plasmid#194716PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hAAVS1 locusDepositorArticleInsertAsCpf1 (AAVS1 Acidaminococcus sp.)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-CAG-AAVS1
Plasmid#115262PurposeFor stable integration and expression (under control of the CAG promoter) of a human NODAL splice variant from the AAVS1 safe harbour locus in human cellsDepositorInsertNODAL (NODAL Human)
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterE1Fa and U6Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_118
Plasmid#213167PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_118
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterE1Fa and U6Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE2-Hygro
Plasmid#214019Purposeinducible PE2 system for controllable prime editing; this plasmid is used to insert PE2 prime editor in one allele of AAVS1 locusDepositorInsertPE2
UseTagsExpressionMammalianMutationPromoterTRE-tightAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNM220_AAVS1 integration helper
Plasmid#211864PurposeCas9 cutting at AAVS1 safe harbor locusDepositorInsertAAVS1
UseCRISPRTagsExpressionMutationN/APromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-Sec61B
Plasmid#207553PurposeHomologous recombination donor to integrate and expression cassette for EGFP-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-Sec61B
UseTagsEGFPExpressionMammalianMutationPromoterEndogenousAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 SNAP-Sec61B
Plasmid#207580PurposeHomologous recombination donor to integrate and expression cassette for SNAPtag-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible SNAPTag-Sec61B
UseTagsSNAPTAGExpressionMammalianMutationPromoterEndogenousAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorInserthuman CD14 (CD14 Human)
UseTagsExpressionMammalianMutationPromotermouse Hb9 (Mnx1) 9kb promoter fragmentAvailable sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar
Plasmid#115640PurposeFor targeted integration and inducible expression of a human NODAL splice variant using doxycyclineDepositorInsertNODAL splice variant (NODAL Human)
UseTagsExpressionMammalianMutationPromoterTRE3GAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
2ERT2-AAVS1 TALEN-L
Plasmid#120544PurposeDrug inducible TALEN targeting the human AAVS1 locus for genome editingDepositorInsertERT2, hAAVS1 1L TALEN
UseLentiviralTagsExpressionMammalianMutationPromoterEF1αAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 pegRNA1 with trimmed attP
Plasmid#222346PurposepegRNA 1 plasmid used for PASSIGE-mediated Bxb1 attP installationDepositorInsertAAVS1 attP-installation pegRNA1
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only