-
Plasmid#219808PurposeSecreted HA-tagged TurboID-NCAN-IL domain for extracellular proximity labelingDepositorInsertIgK (Igk Mouse)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
actb2-SecAnxaV-mKate2-acry-EGFP
Plasmid#123628PurposeUbiquitous zebrafish expression vector containing secreted human AnnexinV tagged to mKate2. Parton lab clone BDN.DepositorInsertAnnexinA5
UseTagsmKate2ExpressionMutationPromoterAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL4(1-147)
Plasmid#195029PurposeThe control vector GAL4 (1-147) was generated by introducing a stop codon immediately after the GAL4 (1-147) sequence in the GAL4-Creb5 (1-128) vectorDepositorInsertGAL4 (1-147)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD043
Plasmid#212913PurposeEncodes the S. cerevisiae 111 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD084
Plasmid#212921PurposeEncodes the HA-tagged S. cerevisiae Tip1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertTIP1 (TIP1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD080
Plasmid#212917PurposeEncodes the S. cerevisiae Aga1p yeast surface display anchor protein as a Type 3 part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA1 (AGA1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD001
Plasmid#212898PurposeEncodes S.cerevisiae AGA2 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA2 (AGA2 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD008
Plasmid#212905PurposeEncodes S. cerevisiae PLB1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertPLB1 (PLB1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD006
Plasmid#212903PurposeEncodes S. cerevisiae MFalpha1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD083
Plasmid#212920PurposeEncodes the HA-tagged S. cerevisiae Sed1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSED1 (SED1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD082
Plasmid#212919PurposeEncodes the HA-tagged S. cerevisiae Cwp2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertCWP2 (CWP2 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD003
Plasmid#212900PurposeEncodes S.cerevisiae ECM14 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertECM14 (ECM14 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD002
Plasmid#212899PurposeEncodes S.cerevisiae CRH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertCRH1 (CRH1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD007
Plasmid#212904PurposeEncodes S. cerevisiae OST1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertOST1 (OST1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD041
Plasmid#212911PurposeEncodes the S. cerevisiae YAR066W Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertYAR066W (YAR066W Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD023
Plasmid#212909PurposeEncodes a hybrid S. cerevisiae OST1 pre- MFalpha1 pro- signal peptide (OST1MFapp) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD004
Plasmid#212901PurposeEncodes S.cerevisiae SUC2 (Invertase) pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSUC2 (SUC2 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD081
Plasmid#212918PurposeEncodes the HA-tagged S. cerevisiae Aga2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA2 (AGA2 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD021
Plasmid#212907PurposeEncodes an engineered S. cerevisiae MFalpha1 pre-pro- signal peptide (MFapp8) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD024
Plasmid#212910PurposeEncodes the wildtype S. cerevisiae MFalpha1 pre-pro- signal peptide (MFappWT) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD042
Plasmid#212912PurposeEncodes the S. cerevisiae HSP150 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertHSP150 (HSP150 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD005
Plasmid#212902PurposeEncodes S. cerevisiae KSH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertKSH1 (KSH1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD061
Plasmid#212915PurposeEncodes the S. cerevisiae SUC2 (Invertase) protein (minus signal peptide) as a Type 3b' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSUC2 (SUC2 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD044
Plasmid#212914PurposeEncodes the S. cerevisiae 142 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD022
Plasmid#212908PurposeEncodes an engineered S. cerevisiae MFalpha1 pre-pro- signal peptide (MFappOPT) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD009
Plasmid#212906PurposeEncodes S. cerevisiae SRL1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSRL1 (SRL1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA ins:TDimer mVenus
Plasmid#210520PurposeExpresses a tandem dimer of mVenus in zebrafish pancreatic beta cells using a zebrafish insulin promoterDepositorInsertTandem dimer mVenus
UseZebrafish expression, tol2 kit gateway-compatibleTagsExpressionMutationPromoterZebrafish insulin promoterAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA ins:R198P mVenus
Plasmid#210519PurposeExpresses mVenus-tagged R198P mutant of Apollo-NADP+ in zebrafish pancreatic beta cells using a zebrafish insulin promoterDepositorInsertApollo-NADP+
UseZebrafish expression, tol2 kit gateway-compatibleTagsmVenusExpressionMutationR198PPromoterZebrafish insulin promoterAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA ins:Apollo-NADP+ mVenus
Plasmid#210518PurposeExpresses mVenus-tagged Apollo-NADP+ in zebrafish pancreatic beta cells using a zebrafish insulin promoterDepositorInsertApollo-NADP+
UseZebrafish expression, tol2 kit gateway-compatibleTagsmVenusExpressionMutationPromoterZebrafish insulin promoterAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
UseTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
UseTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18965_pMQ30_KO_Kan
Plasmid#185394PurposeNon-replicating vector used to create markerless deletion of RR42_RS18965 in C. basilensis 4G11DepositorInsertsRR42_RS18965 upstream flanking homology region
RR42_RS18965 downstream flanking homology region
UseTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18970_pMQ30_KO_Kan
Plasmid#185395PurposeNon-replicating vector used to create markerless deletion of RR42_RS18970 in C. basilensis 4G11DepositorInsertsRR42_RS18970 upstream flanking homology region
RR42_RS18970 downstream flanking homology region
UseTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
CRISPR-StAR4GN (Lenti)
Plasmid#222693PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsGFPExpressionMammalianMutationPGK without BsmBI cutsitePromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_SC_4.26_STARR-seq
Plasmid#220220PurposeAAV-STARR-seq screening vector with 4.26 promoteDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoter4.26Available sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
XRE-pNL1.3[secNLuc]
Plasmid#182295PurposeSecreted Luciferase reporter for AhR activityDepositorInsertXenobiotic Response Element (CYP1A1 Human)
UseTagssecNlucExpressionMammalianMutationPromoterXREAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_A215C
Plasmid#177828PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific 8-oxo-G:C lesion for the purposes of measuring OGG1 activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_A215C
UseTagsExpressionMammalianMutationA215CPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF12J
Plasmid#42943DepositorInsertEN+ Human L1 element (L1RE1 Human)
UseTagsEGFP (opposite strand)ExpressionMammalianMutationAgeI-BclI fragment swapped with nt 1927-3708 from…PromoterCMV MIE, L1 5'UTRAvailable sinceApril 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4B (Lenti)
Plasmid#222691PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPGK without BsmBI cutsitePromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dual-CRISPR-U6-H1(pBP43)
Plasmid#218930PurposeThe backbone lentiviral dual-CRISPR plasmid for making the dual-CRISPR screening libraries.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6 and H1Available sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET-WT SpCas9-NLS-6xHis
Plasmid#207373PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertWT SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationPromoterT7Available sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMax_GFP_C289T
Plasmid#177826PurposeSite-specific mutagenesis of GFP for the purposes of creating a site-specific hypoxanthine lesion for the purposes of measuring MPG activity via Host Cell Reactivation (HCR).DepositorInsertGFP_C289T
UseTagsExpressionMammalianMutationC289TPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4BN (Lenti)
Plasmid#222692PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsGFPExpressionMammalianMutationPGK without BsmBI cutsitePromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPathBrick
Plasmid#65006PurposeE. coli vector for expression of S. pyogenes dCas9, tracrRNA, and nontargeting CRISPR array with BsaI site for inserting user-defined spacer-repeat bricksDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive native promotersAvailable sinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_G299C
Plasmid#177829PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific G:G mispair for the purposes of measuring MMR activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_G299C
UseTagsExpressionMammalianMutationG299CPromoterCMVAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMax_BFP_A191G
Plasmid#177823PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a site-specific U:A mispair for the purposes of measuring UDG activity via Host Cell Reactivation (HCR).DepositorInserttagBFP_A191G
UseTagsExpressionMammalianMutationA191GPromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR1 (Retro)
Plasmid#222687PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPGK without BbsI cutsitePromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only