We narrowed to 6,626 results for: GFP expression plasmids
-
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRK5_mCherry-P2AT2A-EGFP-BRD4-NUT-KS
Plasmid#238282PurposeFor overexpression of mCherry-P2AT2A-EGFP-BRD4-NUT-KSDepositorInsertmCherry-P2AT2A-EGFP-BRD4-NUT-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn-HA-PGRN-LAMP1TM-IRES-GFP
Plasmid#234877PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterhSYnAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG16) PAGER(Gq)
Plasmid#230006PurposeExpresses anti-GFP PAGER(Gq) in mammalian cellsDepositorInsertMT1-LaG16-TEVcs-ALFA-hM1D
UseAAVExpressionMammalianMutationW442A on hM1DPromoterCMVAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG16) PAGER(Gs)
Plasmid#230007PurposeExpresses anti-GFP PAGER(Gs) in mammalian cellsDepositorInsertMT1-LaG16-TEVcs-ALFA-hM1Dxs
UseAAVExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-NSP3SA11-P2A-C1C-EGFP
Plasmid#220810PurposeExpress separately the Rotavirus SA11 NSP3 protein and C1C-EGFPDepositorInsertRotavirus SA11 NSP3-P2A-C1C-EGFP
UseOtherAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS-CT
Plasmid#216763PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS-CT (700 pM) negative control in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS-CT
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 PPP2CA g1
Plasmid#170822PurposePiggyBac Cas13d sgRNA plasmid for PPP2CA knockdownDepositorInsertCas13d PPP2CA gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-2xflox-BRX-eGFP-NLS
Plasmid#217535PurposeAAV vector to drive the expression of eGFP in genetically defined cell populations under the control of the 4xBRE regulatory element of SMAD1 transcription factor and miniXon splicing casette in vivoDepositorArticleInsert4X BRE reporter and miniXon casette (Smad1 Mouse)
UseAAVExpressionMammalianPromoterBMP response element (BRE)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSC-mCh-P2A-ST-EGFP-CAAX
Plasmid#207636PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to mCherry and a SpyTag-EGFP localized to the cell membrane via CAAX tagDepositorInsertphotocaged SpyCatcher-mCh-P2A-SpyTag-EGFP-CAAX
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-Crry-T2A-GFP
Plasmid#205452Purposelentiviral plasmid for expression of mouse CrryDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD24-T2A-GFP
Plasmid#205448Purposelentiviral plasmid for expression of mouse CD24DepositorAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-ACAP1 F280E
Plasmid#203801PurposeAAV vector plasmid expressing human ACAP1 mutation F280E fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-iRFP713(V256C)-P2A-EGFP
Plasmid#198061PurposeThe lentiviral vector for iRFP713(V256C) and EGFPDepositorInsertiRFP713(V256C)
UseLentiviralTagsP2A-EGFPExpressionMammalianMutationV256C mutationPromoterCAGAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT5-d2EGFP-mCherry
Plasmid#201454PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHRSin-IRES2-EmGFP_HPC-4 Ab heavy-6xHIS
Plasmid#187358PurposeLentiviral expression of HPC-4 antibody heavy chain, and 6xHIS tagDepositorInsertHPC-4 antibody heavy chain, and 6xHIS tag
UseLentiviralPromoterSFFVAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgG1-IRES-GFP
Plasmid#187008PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-41-DExCon-antiGFPnanobody-mCherry-R11b
Plasmid#179901PurposeDonor with homologous arms for Rab11b to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-Elo3-GFP11-Ura
Plasmid#177734PurposeER protein Elo3 with a C-terminal, an HA tag and the eleventh β-strand of GFP in yeast plasmid with URA markerDepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_3
Plasmid#178049PurposeCAG tdGFP Lrig1 shRNAmir-3 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_2
Plasmid#178048PurposeCAG tdGFP Lrig1 shRNAmir-2 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_1
Plasmid#178047PurposeCAG tdGFP Lrig1 shRNAmir-1 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Pten_shRNAmir
Plasmid#178044PurposeCAG tdGFP Pten shRNAmir cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertPten_1523 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-intron-L-F-bpA-SV40pA-L-td-sfGFP
Plasmid#178433PurposeCAG tdGFP FLP/FRT cre/lox "NOT" reporter piggyBac transposon (bpA SV40pA stop)DepositorInserttd-sfGFP
UseCre/Lox; Flp/frt, piggybacExpressionMammalianAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KY801: pMVP (L3-L2) P2A-eGFP + polyA
Plasmid#121764PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest.DepositorInsertP2A-eGFP + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-tGFP-Cryz
Plasmid#110378PurposeMammalian expression of turboGFP-CRYZ with FLAG tag, Flp-In T-Rex systemDepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLfa[UAS-Tc'hsp_p-tGFP-SV40]fa
Plasmid#86452PurposeUAS responder construct for misexpression in Tribolium; UAS drives tGFP expression; (Shuttle plasmid); tGFP can be exchanged by other ORFsDepositorInsertUAS-Tc'hsp_p-tGFP-SV40
ExpressionInsectAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG415-GPDp-EGFP-rap1-K3NR
Plasmid#84533PurposeThis plasmid can be used to express EGFP-tagged Rap1K3NR from the GDP promoter in yeastDepositorAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG415-GPDp-EGFP-rap1-K3CR
Plasmid#84534PurposeThis plasmid can be used to express EGFP-tagged Rap1K3CR from the GDP promoter in yeastDepositorAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG415-GPDp-EGFP-rap1-K9R
Plasmid#84535PurposeThis plasmid can be used to express EGFP-tagged Rap1K9R from the GDP promoter in yeastDepositorInsertRAP1 (RAP1 Budding Yeast)
TagsEGFPExpressionYeastMutationK(43,61,69,117,240,246,527,582,651)RPromoterGPDAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG415-GPDp-EGFP-rap1-K651R
Plasmid#84536PurposeThis plasmid can be used to express EGFP-tagged Rap1-K651R from the GDP promoter in yeastDepositorAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Tet1d834-1053-Poly(A)
Plasmid#65561PurposePlasmid for Bxb1-mediated recombination of the GFP-Tet1d834-1053 cDNA into a MIN-tagged locusDepositorInsertTet1 (Tet1 Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationdel(834-1053)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJAT27
Plasmid#204308PurposeFor generating targeting inversions. C-terminal split GFP, expressed in flight muscles.DepositorInsertMHC-GFPc
UseCRISPRPromoterMHCAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJAT18
Plasmid#204307PurposeFor generating targeting inversions. N-terminal split GFP, expressed in flight muscles.DepositorInsertMHC-GFPn
UseCRISPRPromoterMHCAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL5_cHS4-CAG-s36GFPmNG-IRES-PuroR-p2AmCherry3NLS-polyA-cHS4
Plasmid#223540PurposePUFFFIN cassette with s36GFP-mNeonGreen and mCherry-3NLS, strong constitutive promoter CAG, insulated by cHS4 for random integration, puromycin resistance for selection in mammalian cellsDepositorInserts36GFP-mNeonGreen, mCherry-3NLS, PAC
ExpressionMammalianPromoterCAGAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHL047 [15ARE23bp -p(TATA)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246422PurposeFirefly luciferase driven by an AHR responsive minimal promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
R26-CAG-rox-FNF-bpA-3pA-rox-td-sfGFP
Plasmid#180153Purposetd-sfGFP dre reporter with Rosa26 recombineering homology armsDepositorInserttd-sfGFP
UseMouse Targeting; Dre/roxExpressionBacterial and MammalianAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-NIR-FbLAG30
Plasmid#220748PurposeNIR-FbLAG30 expression in bacteria.DepositorInsertNIR-FbLAG30
UseAffinity Reagent/ AntibodyExpressionBacterialMutationFor bacterial cytoplasmic expression, the pelB si…PromoterT7Available SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033)
Plasmid#214852PurposeExpression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs)DepositorHas ServiceAAV PHP.eBInsertCoChR-EGFP
UseAAVAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1_TREtight-FRB-GEM23-Halo-IRES-FKBP-SNAP-GFPNb_EF1a-rtTA3-T2A-Puro-P2A-Thy1.1
Plasmid#197065PurposeDonor plasmid for human AAVS1 locus knock-in, doxycycline-inducible expression of FRB-GEM23-Halo and Adaptor Protein (FKBP-SNAP-vhhGFP4)DepositorInsertsI3-01
Adaptor Protein
UseCRISPRTagsFRB and HaloTagExpressionMammalianMutationCodon-optimised for human cell expressionAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-sfGFP-tdTomato T2A APGST XE
Plasmid#113851PurposeSuperfolder GFP and tdTomato linked by T2A (APGST linker)DepositorInsertsfGFP-T2A-tdTomato
ExpressionMammalianAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-sfGFP-tdTomato T2A V XE
Plasmid#113853PurposeSuperfolder GFP and tdTomato linked by T2A (V linker)DepositorInsertsfGFP-T2A-tdTomato
ExpressionMammalianAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2241
Plasmid#111896PurposessAAV genome with Ple320 (POU4F1 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only