We narrowed to 879 results for: grna cloning vector
-
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3b/LacZ
Plasmid#66199Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3bAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-DsRed-P2A-Bsr
Plasmid#83919PurposeLentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastRDepositorInsertsDsRed-Express2
Bsr
UseCRISPR and LentiviralTagsP2APromoterhUbCAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m/LacZ
Plasmid#66192Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_BbsI-gRNA scaffold-EC73-5'-EcoRI-EC73-3'-HDV_pA_pCMV_EGFP-L202S-P2A-mCherry_pA
Plasmid#176461PurposeVector for constructing retron Ec73ncRNA-gRNA chimeric RNA (Ec73 rgRNA), inserting spacer sequence by BbsI digestion and inserting donor sequence by EcoRI digestion. EGFP(L202S)-P2A-mCherry driven by CMVDepositorInsertBbsI-gRNA scaffold-Ec73ncRNA-EcoRI-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNASAM(gTetO)-TREGFP-PGKpuroBFP-W
Plasmid#112927PurposeCRISPR-a reporter assay lentiviral vector (gTetO)DepositorInserthU6-gRNASAM(gTetO), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
JME4580
Plasmid#129659PurposeHPHex_CrisprCas9-yl_RFP: CAS9 vector with Hygromycinex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GuideVector_BbsI
Plasmid#110692PurposeFor rapid cloning and expression of sgRNAs in mammalian cells. Contains copGFP for easy FACS sorting.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ173
Plasmid#98410PurposeCas9-gRNA lys9 plasmid for lys9 deletion in S. pombeDepositorInsertgRNA targeting Sp.lys9 (SPBC3B8.03 Fission Yeast)
UseCRISPRAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1
Plasmid#194278PurposeExpresses gRNA and dSaCas9-KRAB from lentiviral vectorDepositorInsertshumanized dSaCas9 KRAB T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMK435
Plasmid#236573PurposeCloning vector for PaqCI Golden Gate assembly of ISYmu1 gRNAs into TRV2 Architecture_BDepositorTypeEmpty backboneExpressionPlantAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only