We narrowed to 1,273 results for: grna cloning vector
-
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBBK04 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitHygR,AmpR)
Plasmid#178988PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK02 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitKanR, AmpR)
Plasmid#178986PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK06 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitNatR,AmpR)
Plasmid#178990PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitNourseothrycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC6 (pP18(T)_B11-AVA4069)
Plasmid#239304PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC6DepositorInsertU6-driven sgRNA targeting EXOSC6 (EXOSC6 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC7 (pP18(T)_C4-AVA4066)
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DIS3 (pP18(T)_A5-AVA4073)
Plasmid#239308PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DIS3DepositorInsertU6-driven sgRNA targeting DIS3 (DIS3 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-NONO-1
Plasmid#127654PurposeKnock-out of human NONO (guide only)DepositorInsertNONO sgRNA (NONO Human)
ExpressionMammalianAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Guide-Generating Vector
Plasmid#125752PurposeGuide-Generating Vector for creating the Cys4-guide-scaffold structure in the first round of assemblyDepositorInsertCys4-GFPdropout-SpCas9scaffold
UseSynthetic BiologyAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pW299-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-tagBFP-P2A-BlastR
Plasmid#189943PurposeLentiviral vector to co-express an spsgRNA with NLS-tagBFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1
Plasmid#194278PurposeExpresses gRNA and dSaCas9-KRAB from lentiviral vectorDepositorInsertshumanized dSaCas9 KRAB T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMB1052:miniTol2-U6-(empty)SaCas9_gRNA-CAG-Cre-P2A-NeoR-WPRE
Plasmid#168108PurposeTol2 transposon vector of empty U6-S.aureus Cas9 gRNA cassette and CAG-driven Cre-NeoRDepositorTypeEmpty backboneUseCRISPR and Cre/LoxAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW211-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170809PurposeLentiviral vector to co-express an spsgRNA with NLS-mNeonGreenDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW213-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170811PurposeLentiviral vector to co-express an sasgRNA with NLS-mNeonGreenDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianPromoterU6 for sgRNA and CBh for dCas9Available SinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmcGAS
Plasmid#208385PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine cGAS gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pW212-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170810PurposeLentiviral vector to co-express an spsgRNA with NLS-mScarlet-IDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW214-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170812PurposeLentiviral vector to co-express an sasgRNA with NLS-mScarlet-IDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC130: pAAV.CMV-CasRx-VEGFA sgRNA
Plasmid#203443PurposePlasmid expressing active RfxCas13d with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM149: pAAV.CMV-Cas13e-VEGFA sgRNA
Plasmid#203447PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-enOsCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197026PurposeVector encoding a human codon-optimized enOsCas12f1 driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized enOsCas12f1
ExpressionMammalianMutationD52R / T132RPromoterCBh, CMV, hU6Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-OsCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197024PurposeVector encoding a human codon-optimized OsCas12f1 driven by CBh promoter, guide RNAs compatible with OsCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized OsCas12f1
ExpressionMammalianPromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only