We narrowed to 3,284 results for: cgas
-
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
UseTagsExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW229-lenti-sg2-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189945PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg2-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #2
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW230-lenti-sg3-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189946PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg3-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #3
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.002
Plasmid#184972PurposeExpress -Eco1 ADE2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 12
UseTagsExpressionYeastMutationADE2 donor P272stopPromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.039
Plasmid#184973PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v1
UseTagsExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_2
Plasmid#190701PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 2
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6Available sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRTagsExpressionMammalianMutationNonePromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_3-2
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorInsertSki targeting gRNA (Ski Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK17 pCAS-Tyr-[gRNA: 7=HIS3] (SplitKanR, AmpR)
Plasmid#179001PurposeSp.Cas9 and gRNA yeast expression vector with HIS3 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Eomes gRNA#3
Plasmid#170836PurposeCas9-mediated knockout of Eomes in mammalian cellsDepositorInsertEomes (Eomes Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only