We narrowed to 14,123 results for: cas9 genes
-
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JME5000
Plasmid#129661PurposeEYK1ex_CrisprCas9-yl_RFP: CAS9 vector with EYK1ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRR2
Plasmid#166097PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMK
Plasmid#62818PurposeBacterial constitutive S. pyogenes Cas9 expression plasmidDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pITI1
Plasmid#166094PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-Sa-TdTom. Reporter
Plasmid#99652PurposeRed fluorescent reporter that can be activated by dSa Cas9 activator indicating activityDepositorInsertRFP
ExpressionMammalianMutationdead Cas9Available SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMG005_mNeonGreen_P2A
Plasmid#237215PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmNeonGreen-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMG008_mCherry_P2A
Plasmid#237216PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmCherry-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP003
Plasmid#101164PurposeE. coli/S. cerevisiae amdS shuttle vector allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
Tags3x FLAGExpressionMammalianPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRU294
Plasmid#167689PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU295
Plasmid#167694PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU324
Plasmid#167691PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU319
Plasmid#167686PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU53
Plasmid#167679PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU54
Plasmid#167680PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU293
Plasmid#167688PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU323
Plasmid#167690PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU292
Plasmid#167687PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGY18
Plasmid#221708PurposeEmpty Cas9 vector for multiplex gene editing in fungiDepositorTypeEmpty backboneUseCRISPR; AspergillusExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-2
Plasmid#61737PurposeStreptomyces expression of codon-optimized Cas9 and custom gRNADepositorInsertssSpCas9
gRNA cassette
UseCRISPRExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL) and rpsL(XC)-BbsIAvailable SinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
NG-ABEmax
Plasmid#124163PurposeA-to-G base editorDepositorInsertTadA-TadA(evo)-Cas9-NG
ExpressionMammalianAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
4xNLS-pMJ915v2
Plasmid#88917PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3613
Plasmid#42251PurposeExpresses Cas9 nuclease (Streptococcus pyogenes) from CMV and T7 promotersDepositorInsertStreptococcus pyogenes Cas9
UseCRISPR; Zebrafish expressionPromoterCMVAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
4xNLS-pMJ915v2-sfGFP
Plasmid#88921PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 nog
Plasmid#120251PurposeCRISPR-Cas9 SunTag system to target VP64 to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_VP64_linker sfGFP_scFv_UBQ10_Insulator_ UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd nog
Plasmid#115488PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator_ UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRU55
Plasmid#167684PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::asCpf1
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
5aa SunTag VP64 EVD
Plasmid#115483PurposeCRISPR-Cas9 SunTag system to target VP64 to the EVD/ATR loci each with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTetO-hOSK-CASH-1
Plasmid#188977PurposeA CASH-1 GSH targeting, doxycycling inducible humanized Oct4, Sox2, and Klf4 expressing CRISPR/Cas9 donor plasmid.DepositorInsertDoxycycline inducible reprogramming donor cassette
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only