We narrowed to 6,616 results for: rel
-
Plasmid#166714Purposeexpresses AMOT(L106P) in mammalian cellsDepositorInsertAngiomotin p130 L106P (AMOT Human)
Tags2xHAExpressionMammalianMutationchanged leucine 106 to prolinePromoterCMV promoterAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-AMOT p130∆PPxY1(A112K)
Plasmid#166715Purposeexpresses AMOT(A112K) in mammalian cellsDepositorInsertAngiomotin p130 A112K (AMOT Human)
Tags2xHAExpressionMammalianMutationchanged alanine 112 to lysinePromoterCMV promoterAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ΔOB in mammalian cellsDepositorAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
KIF13B
Plasmid#163907PurposeFull length mouse KIF13B for purification from insect cellsDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
KIF13B 1-584
Plasmid#163908PurposeMotile fragment of mouse KIF13B (aa 1-584) for purification from insect cells.DepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ir7a-T2A-QF2 HDR plasmid
Plasmid#140943PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7a geneDepositorInsertIr7a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7a-right-HDR-arm
Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-HA-GlpG(D243G/L244G/F245G/M247G/S248G/M249G/A250G)
Plasmid#155136PurposeExpresses N-terminally GFP- and HA-tagged E. coli GlpG D243G/L244G/F245G/M247G/S248G/M249G/A250G variant from pGEX 4P-1DepositorInsertGlpG (glpG Escherichia coli)
TagsGST and HAExpressionBacterialMutationD243G/L244G/F245G/M247G/S248G/M249G/A250GPromotertacAvailable SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM33
Plasmid#154167PurposeAedes aegypti Rel2 (long isoform) with C-terminal IκB domain deleted, expressed under the IE1 promoter and hr5 enhancer from Autographa californica nuclear polyhedris virus.DepositorInsertRel2 (long isoform)
TagsFLAGExpressionInsectMutationC-terminal IκB domain deletedPromoterIE1 promoter and hr5 enhancer from Autographa cal…Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAMAHISTEV_PfeAR480A
Plasmid#128944Purposeexpresses R480A mutant of PfeA in E. coliDepositorInsertferric enterobactin receptor
TagsTEV protease cleavable 7xHis and TamAExpressionBacterialMutationSignal peptide sequence has been removed (1-75), …PromoterT7Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTAMAHISTEV_PfeAG324V
Plasmid#128947Purposeexpresses G324V mutant of PfeA in E. coliDepositorInsertferric enterobactin receptor
TagsTEV protease cleavable 7xHis and TamAExpressionBacterialMutationSignal peptide sequence has been removed (1-75), …PromoterT7Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG-WPRE
Plasmid#127869PurposepAAV plasmid expressing an NOS-IN133.3xFLAG fusion protein under the hSyn promoterDepositorAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
APBA3_PDZ_1
Plasmid#103956PurposeProtein expression and purification of XIIL2 PDZ1 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL16_PDZ_3
Plasmid#103929PurposeProtein expression and purification of IL16 PDZ3 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
CYTIP_PDZ_1
Plasmid#103930PurposeProtein expression and purification of PSCDBP PDZ domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
LIMK1_PDZ_1
Plasmid#103932PurposeProtein expression and purification of LIMKINASE BGL1 PDZ domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
GRIP1_PDZ_4
Plasmid#103934PurposeProtein expression and purification of GRIP PDZ4 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
APBA1_PDZ_1
Plasmid#103942PurposeProtein expression and purification of APBA1 PDZ1 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-C-SH2
Plasmid#111419Purposeexpress murine Syk (C)SH2 domain (His 162 to Gln 264), in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (C)SH2 domain (His 162 to Gln 264), without any tag (Syk Mouse)
ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-C-SH2+IA
Plasmid#111418Purposeexpress murine Syk (C)SH2 domain plus interdomain A (Phe 119 to Gln 264), in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (C)SH2 domain plus interdomain A (Phe 119 to Gln 264), without any tag (Syk Mouse)
ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
vsv-Incenp 1-48-GFP
Plasmid#108507Purposeexpression of vsv-INCENP 1-48-EGFPDepositorInsertCEN-Box of INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationonly CEN box of INCENPPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
vsv-Incenp 1-58-GFP
Plasmid#108508Purposeexpression of vsv-INCENP 1-58-EGFPDepositorInsertCEN-Box of INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationonly CEN box of INCENPPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
vsv-Incenp 1-63-GFP
Plasmid#108509Purposeexpression of vsv-INCENP 1-63-EGFPDepositorInsertCEN-Box of INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationonly CEN box of INCENPPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDT1:HDT1-GFP
Plasmid#108565PurposeArabidopsis transformation, expresses HDT1/GFP fusion with HDT1 promoter to study expression pattern in rootsDepositorAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDT1:GUS
Plasmid#108441PurposeArabidopsis transformation, expresses HDT1 promoter/GUS fusion to study expression pattern in rootsDepositorAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-YFP-566CT
Plasmid#41677DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-CFP-571CT
Plasmid#41680DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-YFP-571CT
Plasmid#41679DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-CFP-566CT
Plasmid#41678DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; CFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E,NoCys)
Plasmid#66875PurposeExpresses a cysteine-free version of pET30Xa-SBL1(160E) (4Cys to Ser) with N-term HistagDepositorInsertsoybean lipoxygenase-1 (S160E) with all Cys to Ser mutations
TagsHistagExpressionBacterialMutationS160E; changed 4 (all) cysteines to serinePromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry-miniSOG-H2B-C-10
Plasmid#57789PurposeLocalization: Nucleus/Histones, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertH2B (H2BC11 Human)
TagsPA-mCherry-miniSOGExpressionMammalianMutationD26G and V119I in H2BPromoterCMVAvailable SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S620T
Plasmid#53059PurposeExpresses alpha subunit of S620T hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 620 to ThreoninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1(+)mGAT1CFP45
Plasmid#41676DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsCFPExpressionMammalianMutation“Monomerizing” CFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1YFP45
Plasmid#41675DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Mouse, Synthetic)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; 45 C-terminal-…PromoterCMVAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-AbrR683AN795A-HisC
Plasmid#32510DepositorAvailable SinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR-hSOX10-G128A
Plasmid#24737DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationG replaced with A at position 128Available SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2beta 6X mutant
Plasmid#128816PurposeTo make virus expressing Doc2beta 6X mutantDepositorInsertDoc2beta (Doc2b Rat)
UseLentiviralTagsIRES-EGFPMutationD163A, D218A, D220N, D303A, D357A, D359APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p65
Plasmid#111190Purposefluorescent fusion proteinDepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-TfR20-SNAP-IRES-Puro
Plasmid#171018PurposeLentiviral expression of a transferrin receptor-SNAP-tag fusion in mammalian cellsDepositorInsertTransferrin receptor (Human) - SNAP-tag (TFRC Human)
UseLentiviralTagsSNAPtag and TfRExpressionMammalianPromoterEF1Available SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_CRF1.0
Plasmid#208655PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in mammalian cellsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Mito-7
Plasmid#57773PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFP-HsNRF2 (NFE2L2)
Plasmid#194303PurposeMammalian expression of human NRF2 (NFE2L2) fused to EGFP at the N-terminus. Parton lab clone KTHDepositorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2AL200R150G-EGFP-LC3B-RFP-LC3BΔG
Plasmid#168998PurposeExpresses GFP-LC3-RFP-LC3ΔG in zebrafish to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseUnspecifiedTagsEGFP and mRFP1Available SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only