We narrowed to 30,828 results for: des.2
-
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-microRNA 338-2-Dendra2
Plasmid#97138Purposeoverexpression of microRNA and Dendra2 in ZebrafishDepositorInsertmicroRNA 338 2 Dendra2
UseZebrafishAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-microRNA 218a-2-Dendra2
Plasmid#97125Purposeoverexpression of microRNA and Dendra2 in ZebrafishDepositorInsertmicroRNA 218a 2 Dendra2
UseZebrafishAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Neo (657-2)
Plasmid#17447Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, NeoDepositorInsertGFP
UseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-CoV-2-HiBiT-N
Plasmid#215815PurposeExpresses N protein with HiBiT tag in mammalian cellsDepositorInsertSARS-CoV-2 HiBiT Nucleocapsid (N )
ExpressionMammalianAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pssAAV-2-hGFAP-GeNL-WPRE-bGHp(A)
Plasmid#221455PurposeAAV vector expressing GFAP-GeNLDepositorInsertGreen enhanced Nano-lantern
UseAAVPromoterhGFAPAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-lox-GFP shRNA p19-2
Plasmid#14091DepositorAvailable SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2
Plasmid#70658PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
3149 pSFFV-neo Bcl-2 cDNA
Plasmid#8750DepositorInsertBcl-2 (Bcl2 Mouse)
ExpressionMammalianAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET28C-mCherry-SARS-CoV-2-Nucleocapsid
Plasmid#204403PurposeE. coli expression of full-length SARS-CoV-2 nucleocapsid with an N-terminal mCherry tagDepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-OPTN (2-119)
Plasmid#208867PurposeStably express GFP-tagged OPTN (2-119aa) for CID induced mitophagyDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH49 - [PVQp | mScarlet | tbb-2 UTR]
Plasmid#200325PurposemScarlet BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | wrmscarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00003755, nlp-17Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCZGY1026 COX8aN::miniSOG in pENTR[1-2]
Plasmid#66752PurposeminiSOG fused to N terminal 29 aa of human Cox8a for targeting to the mitochondriaDepositorInsertminiSOG
TagsCOx8aN (N terminal 29 aa)ExpressionWormAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRM3 - [BAGp | mScarlet | tbb-2 UTR]
Plasmid#204616PurposemScarlet BioPart for BAG neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[BAGp | wrmScarlet | tbb-2 UTR]
ExpressionWormAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRM4 - [BAGp | gfp | tbb-2 UTR]
Plasmid#204617Purposegfp BioPart for BAG neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[BAGp | gfp | tbb-2 UTR]
ExpressionWormAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LB595 (Bcl-2 promoter CRE mut)
Plasmid#15243DepositorInsertB-cell lymphoma/leukemia-2 (BCL2 Human)
UseLuciferaseTagsLuciferaseExpressionBacterialMutationMutated CRE site at -1537 changed from GTGACGTTA …Available SinceAug. 1, 2007AvailabilityAcademic Institutions and Nonprofits only