We narrowed to 6,480 results for: poly
-
Plasmid#225542PurposeExpresses histone deacetylase 10 (HDAC10) humanized catalytic domain, also known as hzHDAC10, in Escherichia coli cells.DepositorInsertHistone Deacetylase 10 humanized catalytic domain (hdac10 Zebrafish)
UseTagsHis6-MBP tag with cleavable TEV siteExpressionBacterialMutationMutated A24E and D94APromoterT7Available sinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K48R/K63R)-GFP
Plasmid#212795PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R/K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R/K63R)-GFP
UseIntegrative vectorTagsExpressionYeastMutationCUb(K48R/K63R)PromoterCUP1Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Rat, Synthetic)
UseAAVTagsExpressionMutationPromoterDlxAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianMutationPromoterhuman U6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_S172A_M173A RAD23A
Plasmid#201574PurposeExpresses a variant of human RAD23A containing mutations S172A and M173A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutations S172A and M173APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V195A RAD23A
Plasmid#201575PurposeExpresses a variant of human RAD23A containing mutation V195A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutation V195APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A RAD23A
Plasmid#201577PurposeExpresses a variant of human RAD23A containing mutation C344A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutation C344APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F354A RAD23A
Plasmid#201578PurposeExpresses a variant of human RAD23A containing mutation F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutation F354APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A_F354A RAD23A
Plasmid#201579PurposeExpresses a variant of human RAD23A containing mutations C344A and F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutations C344A and F354APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23B_delta aa 276-339 (delta XPC-binding domain)
Plasmid#201547PurposeExpresses a mutant form of human RAD23B that lacks the XPC-binding domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
UseTagsFLAGExpressionMammalianMutationLacks residues 276-339PromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A
Plasmid#201438PurposeExpresses human RAD23A with an N-terminal FLAG tag in mammalian cellsDepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc253
Plasmid#207464PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 253DepositorInsertMTdTc253 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationSer253Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…PromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc188
Plasmid#207463PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 188DepositorInsertTdTc188 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationCys216Ser, Cys302Ala, Cys378Ala, and Cys438SerPromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc180
Plasmid#207462PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 180DepositorInsertTdTc180 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationGlu180Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…PromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc302
Plasmid#207461PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 302DepositorInsertTdTc302 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys378Ala, and Cys438SerPromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorInsertTRR 2011-2431 (trr Fly)
UseTagsGSTExpressionBacterialMutationmutation G2304D (GGC/GAC)PromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorInsertTRX (w Fly)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Flag-PolB(K206A/K244A/T304I)-Puro
Plasmid#177145PurposeLentiviral vector expressing Flag-PolB(K206A/K244A/T304I) and a puromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorInsertNQO1 (NQO1 Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(L301R/V303R/V306R)
Plasmid#177137PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(L301R/V303R/V306R) with a TEV protease site located between the GST tag and PolB(L301R/V303R/V306R)DepositorInsertPolB (POLB Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(K206A/K244A/T304I)
Plasmid#177134PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A/T304I) with a TEV protease site located between the GST tag and PolB(K206A/K244A/T304I)DepositorInsertPolB (POLB Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
UseTags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
UseTags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Flag-Rheb-12Rs
Plasmid#165023Purposeexpression of Flag-Rheb-12Rs mutant protein in mammalian cells (all the lysine residues on Rheb except the K19 and K120 are mutated to arginines).DepositorInsertRheb-12Rs (RHEB Human)
UseLentiviralTagsflagExpressionMammalianMutationAll the lysine residues except K19 and K120 are c…PromoterAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-2
Plasmid#159930PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, CBhAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, CBhAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-598)_quadruple_mutant
Plasmid#135441PurposeExpresses SFPQ 214-598 quadruple mutant (L535A, L539A, L546A, M549A) with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
UseTagsHexahistidineExpressionBacterialMutationL535A, L539A, L546A, M549APromoterT7Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 T78R L84R T92R V118R
Plasmid#112106PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorInsertDynamin1 (DNM1 Human)
UseTagsEGFPExpressionMammalianMutationT78R L84R T92R V118RPromoterCMVAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
hASXL(1-115)-luciferase
Plasmid#106427PurposeExpresses human ASXL1 (amino acids 1-115) fused to the N-terminal of firefly luciferaseDepositorInsertaddition sex combs like 1 ASXL1 (ASXL1 Human)
UseTagsluciferaseExpressionMammalianMutationamino acids 1-115 fused to luciferasePromoterAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GST-CHD5-WT-FRAG
Plasmid#68873PurposeIPTG inducible bacterial expression of CHD5 fragmentDepositorInsertCHD5 (CHD5 Human)
UseTagsGSTExpressionBacterialMutation331-672aaPromotertacAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorInsertmouse Ins2 gene partial (Ins2 Mouse)
UseTagsExpressionBacterialMutationPromoterlacAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mScarlet-hCenpC
Plasmid#171490PurposeT7 promotor drives in vitro transcription of mScarlet-tagged human hCenpC mRNADepositorInsertCenpC (CENPC Human)
UsePgehmeTagsmScarletExpressionMutationPromoterT7Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
Plasmid#107581PurposeB. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertmCherry
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterpdh promoter Bacillus megaterium DSM319Available sinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoEb
Plasmid#121901PurposePlasmid for making zebrafish apoEb in situ probeDepositorInsertApoeb (apoeb Zebrafish)
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DN-RFX
Plasmid#52296PurposeDominant-negatively inhibits RFX (regulatory factor X) transcription factor. Made of mouse RFX1 DNA binding domain (400-527 aa) and C-terminal myc tag.DepositorInsertDominant negative RFX
UseTagsMycExpressionMammalianMutationPromoterCAG promoterAvailable sinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoEa
Plasmid#121900PurposePlasmid for making zebrafish apoEa in situ probeDepositorInsertApoEa (apoea Zebrafish)
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-CCR5-Cys3A
Plasmid#222313PurposeSynchronize the trafficking of CCR5-Cys3A from the ER.DepositorInsertStreptavidin-KDEL and CCR5-Cys3A fused to SBP-EGFP (CCR5 Human)
UseTagsExpressionMammalianMutationC321A, C323A, C324APromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mClover3-bElys
Plasmid#171494PurposeT7 promotor drives in vitro transcription of mClover3-tagged bovine Elys mRNADepositorInsertElys (AHCTF1 B. tarus (bovine))
UsePgehmeTagsmClover3ExpressionMutationPromoterT7Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A Prk-
Plasmid#162694Purposep1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
UseTagsN terminal 6x His tag on PRKExpressionBacterialMutationPrk inactive (K20M S21A native protein, this map …PromoterPLtet0-1 promoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoBa
Plasmid#121897PurposePlasmid for making zebrafish apoBa in situ probeDepositorInsertApoBa (apoba Zebrafish)
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase
Plasmid#112202PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1), codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6, codon optimized for expression in E. coli K12
UseTags6XHISExpressionBacterialMutationPromoterN/AAvailable sinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hTGM1-Flag
Plasmid#180406Purposelentiviral transduction of human TGM1 (with a C-terminal Flag tag) geneDepositorInsertTGM1 (TGM1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Click editor (CE1) - pCMV-T7-PCV2-nCas9-EcKlenow (EMK488)
Plasmid#208942PurposeThe CE1 construct, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCJ136
Plasmid#162665PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
UseTagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo
Plasmid#212821PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo in mammalian cellsDepositorInsertEGFR* (EGFR Budding Yeast, Human)
UseTagsCUboExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only