We narrowed to 7,666 results for: trac
-
Plasmid#212985PurposeEncodes Poliovirus type I Mahoney 3ABC with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertPoliovirus Type I Mahoney 3ABC C147R
UseMammalian cell free protein expressionTagsHAMutationcysteine 147 in 3C changed to argininePromoterT7Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVA71_VP12A_C110A
Plasmid#212976PurposeEncodes EV-A71 4643 VP12A with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertEnterovirus A71 4643 VP12A C110A
UseMammalian cell free protein expressionTagsHA tagMutationchanged cysteine 110 from 2A to alaninePromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_polio_VP12A_C109R
Plasmid#212987PurposeEncodes Poliovirus type I Mahoney VP12A with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertPoliovirus Type I Mahoney VP12A C109R
UseMammalian cell free protein expressionTagsHAMutationCysteine 109 from 2A mutated to argininePromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmPop2a-dsRNAres-V5His6_K
Plasmid#146719PurposeInsect Expression of DmPop2a-dsRNAresDepositorInsertDmPop2a-dsRNAres (Pop2 Fly)
ExpressionInsectMutationORF extracted from CG5684-Pa; NM_140281.2, with o…Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmPop2a-dsRNAres-V5His6_K
Plasmid#146717PurposeInsect Expression of DmPop2a-dsRNAresDepositorInsertDmPop2a-dsRNAres (Pop2 Fly)
ExpressionInsectMutationORF extracted from CG5684-Pa; NM_140281.2, with o…Available SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA1DZ
Plasmid#114168PurposeStart-Stop Assembly Level 1DZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1DE
Plasmid#114169PurposeStart-Stop Assembly Level 1DE plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1EZ
Plasmid#114170PurposeStart-Stop Assembly Level 1EZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1AZ
Plasmid#114162PurposeStart-Stop Assembly Level 1AZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1AB
Plasmid#114163PurposeStart-Stop Assembly Level 1AB plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1CD
Plasmid#114167PurposeStart-Stop Assembly Level 1CD plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM103: 150bp Hps2 RFP on pCM66T
Plasmid#74744PurposepCM66T with shortened pHps2 promoter driving RFP expression (maxRFP = BBa_E1010)DepositorInsertRFP (BioBrick part number BBa_E1010)
UseSynthetic BiologyExpressionBacterialPromoterpHps2, trimmed (extracted from Methylovorus gluco…Available SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFD152
Plasmid#125546Purposederivative of pFD116 with an optimized RBS for E. coliDepositorInsertoptimized RBS
UseCRISPRPromoteranhydrotetracycline Ptet promoterAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ack
Plasmid#62654PurposeArabinose inducible lambda red and anhydrotetracycline inducible sgRNA expressionDepositorInsertexo, beta, gam, sgRNA
ExpressionBacterialAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV
Plasmid#16403PurposeShuttle vector for use in AdEasy System. Used for expression of transgenes under a CMV promoter when no GFP tracer is desired.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseAdenoviralExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCM157
Plasmid#45863DepositorInsertcre recombinase
UseCre/LoxExpressionBacterialPromoterlacAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-N-FLAG-hBirA*-TLK1-WT
Plasmid#218834PurposeExpresses N-terminal BirA*-tagged human wild type TLK1 variant 5 for BioID experiments.DepositorAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQFT-mNG
Plasmid#203675PurposepQFT with mNeonGreen under control of PQJDepositorInsertmNeonGreen
ExpressionBacterialPromoterPQJAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRU1156
Plasmid#14473DepositorInsertGfp-mut3.1-GusA
ExpressionBacterialAvailable SinceApril 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pQF-lacZ
Plasmid#48094PurposeCumate-inducible expression of lacZDepositorInsertE. coli lacZ
ExpressionBacterialPromoterPQ5Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCM130
Plasmid#45828DepositorTypeEmpty backboneUseLow-background broad-host-range promoter-probe ve…PromoternoneAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJS101
Plasmid#118280PurposeExpresses GFPmut2 with low cell-to-cell variation on a low-copy plasmid and tetracycline inductionDepositorInsertGFPmut2
ExpressionBacterialPromoterpLtetO-1Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
L1PB26- pAHP6--PhiC31-NLS-tUBQ1 + pGATA23--Bxb1-SAUR-tUBQ10
Plasmid#219701PurposeLevel 1 PhiC31 and Bxb1 integrase construct for tracking of lateral root development: pAHP6 promoter for PhiC31 and pGATA23 promoter for Bxb1, NLS tag for PhiC31 and RNA degradation tag for Bxb1DepositorInsertpAHP6::PhiC31-NLS:tUBQ1 + pGATA23::Bxb1-SAUR:tUBQ10
ExpressionPlantAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-NICD
Plasmid#26891DepositorAvailable SinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-) HuTF-Fc-His tag
Plasmid#183253PurposeSoluble expression of the extracellular domains of human tissue factor (TF)-FcDepositorAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQR
Plasmid#48099PurposeCumate-inducible expression of mCherry-tagged fusion proteinDepositorTypeEmpty backboneTags3xFLAG and mCherryExpressionBacterialPromoterPQ5Available SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAT112TAG-SepT
Plasmid#34624DepositorInserttRNA^Sep
ExpressionBacterialPromoterlppAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA
Plasmid#45789DepositorInsertsdeGFP
Tetracycline repressor
araC
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterOR2-OR1-Pr (bacteriophage Lambda with one mutatio…Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSR1154
Plasmid#221653PurposeTetracycline sensor v3 for Staphylococcus aureusDepositorInsertssfGFP cassette
TetR cassette
UseSynthetic BiologyExpressionBacterialPromoterPXyl-TetO and PZwfAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:3xHA-ccdb + RUBY
Plasmid#233307PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and RUBY markerDepositorInsertUbi:3xHA-ccdb + RUBY
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMAZe
Plasmid#60877PurposeReporter construct for lineage tracing and mosaic analysis in zebrafish.DepositorInsertshsp70l promoter
Cre
dTomato
UAS promoter
Gal4VP16
UseZebrafish expressionAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMevB
Plasmid#17819DepositorInsertmevalonate kinase, phosphomevalonate kinase, mevalonate pyrophosphate decarboxylatse
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
h3.7SP-Crtta
Plasmid#20180DepositorInserth3.7SP-Crtta (SFTPC Human)
ExpressionMammalianAvailable SinceMarch 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMS2-2
Plasmid#220628PurposePlasmid allows you to place the RNA sequence of interest next to two MS2 coat protein recognition sites.DepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 FLAG-BMP2-Fc
Plasmid#115771PurposeExpression of the extracellular domain of BMP2 with N-terminal FLAG tag and C-terminal hIgG tag.DepositorAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR_TiTRE
Plasmid#172128PurposeEntry vector for tightly controlled gene expression by a tetracycline-responsive promoterDepositorTypeEmpty backboneUseGateway CloningExpressionMammalianPromotertight TREAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBTM116-D9
Plasmid#111232Purposeyeast expression vectorDepositorInsertccdB-cassette
ExpressionYeastAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-ZtTA
Plasmid#26082DepositorInserta loxP-flanked β-geo preceding the tetracycline transactivator tTA
UseMouse TargetingAvailable SinceNov. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCDW114
Plasmid#70061Purposeartificial transcription template "wild-type"DepositorInsertlambda PR' - repeat cassette - E. coli rpoB - lambda TR'
Available SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDW115
Plasmid#70062Purposeartificial transcription template "pause ablation"DepositorInsertlambda PR' A+2G T+6G - repeat cassette - E. coli rpoB - lambda TR'
Available SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQHD
Plasmid#48102PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of HA-tagged fusion proteinDepositorTypeEmpty backboneTagsHA tagExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
xfz3N/pCS2+
Plasmid#16328DepositorInsertfrizzled-3 (fzd3.L Frog)
UseVertebrate expressionMutationExtracellular ligand binding domain of Xenopus fr…Available SinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pQFD
Plasmid#48101PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of 3xFLAG-tagged fusion proteinDepositorTypeEmpty backboneTags3xFLAGExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQYD
Plasmid#48104PurposeDestination plasmid (Gateway cloning) for cumate-inducible expression of SYFP2-tagged fusion proteinDepositorTypeEmpty backboneTagsSYFP2ExpressionBacterialPromoterPQ5Available SinceJan. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
xfz2N/pCS2+
Plasmid#16329DepositorInsertfrizzled-2 (fzd2 Frog)
UseVertebrate expressionMutationExtracellular ligand binding domain of Xenopus fr…Available SinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO(SERT-HA)-3xmiR122-WPRE-HGHpA
Plasmid#220937PurposeFLP-dependent serotonin transporter overexpression vector for non-invasive gap junction tracingDepositorArticleAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + RUBY
Plasmid#233318PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and RUBY markerDepositorInsertDEXsynth:3xhA-ccdb + RUBY
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DEXsynth:3xhA-ccdb + mcherry
Plasmid#233313PurposeGATEWAY compatible vector with a dexamethasone (DEX)-inducible promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertDEXsynth:3xhA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:3xHA-ccdb + mcherry
Plasmid#233301PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of 3xHA tag paired with ccdb selection toxin and mCherry markerDepositorInsertUbi:3xHA-ccdb + mcherry
UseGateway CloningTags3xHAAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only