We narrowed to 5,049 results for: Mos
-
Plasmid#176997PurposeMammalian lentiviral expression vector encoding JAM2DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
CRYZL1_pLENTI-CAG-IRES-GFP
Plasmid#177004PurposeMammalian lentiviral expression vector encoding CRYZL1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
KCNJ15_pcDNA6.2/EmGFP-Bsd
Plasmid#176981PurposeMammalian expression vector encoding KCNJ15 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRYZL1_pcDNA6.2/EmGFP-Bsd
Plasmid#176941PurposeMammalian expression vector encoding CRYZL1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 4-199
Plasmid#115325PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ir7f-T2A-QF2 HDR plasmid
Plasmid#140942PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7f geneDepositorInsertIr7f-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7f-right-HDR-arm
Mutation4 point mutations (annotated on plasmid map) were…Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-B
Plasmid#66190Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLViN-E-cadherin-GFP
Plasmid#229710PurposeLentiviral expression of E-cadherin-GFPTG in mammalian cellsDepositorInsertCDH1 E-CADHERIN Human (CDH1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-N
Plasmid#66191Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-UBR5
Plasmid#52050PurposeCMV driven mammalian expression of UBR5 with an N-termianl GFP fusionDepositorAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-H
Plasmid#66189Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN113 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26
Plasmid#86233PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Neomycine selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcdna 3.1 DSG-3 Tension Sensor
Plasmid#182717Purposeexpresses DSG-3 TSmodDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN395 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE targeting
Plasmid#92141PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28b-DiCas7-11-His
Plasmid#234482PurposePlasmid for bacterial expression and purification of DiCas7-11 protein (human codon-optimized)DepositorInsertDiCas7-11
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Vhh-LaminB-mNeonGreen-IRES-myr-BFP (JDW 1353)
Plasmid#229845PurposeA CAGGS-driven expression vector containing a vhh-Lamin nanobody for nuclear lamina labeling followed by an IRES and a myristoylated TagBFP for labeling the cell membrane.DepositorInsertLamin nanobody
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGT9054
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX GFP Mps1 wt
Plasmid#63702PurposeInducible expression of GFP-Mps1 fusion in mammalian cellsDepositorAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-T4DNApol (JO638)
Plasmid#208956PurposeA variant CE1 construct with T4 DNA polymerase (-exo, activity enhanced), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-T4pol-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), T4Pol(-exo;D189A/E191A/L412M)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29(+exo) (LM2938)
Plasmid#208957PurposeA variant CE1 construct with Phi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 variant click editor (CE1) - pCMV-T7-PCV2-nSaCas9-EcKlenow (MLE194)
Plasmid#217801PurposeVariant CE1 construct with SaCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSaCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSaCas9(N580A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-DCV-nCas9-EcKlenow (JO608)
Plasmid#208946PurposeA variant CE1 construct with DCV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertDCV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-B KD/MD
Plasmid#226410PurposeExpression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-B (VAPB Human)
TagsHA, T7-Xpress tag, and mCherryExpressionMammalianMutationK87D/M89D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-EcKlenow fusion - pCMV-T7-PCV2-EcKlenow (JO1421)
Plasmid#217804PurposeUnfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only