Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 919 results for: IRE;

Showing: 41 - 80 of 919 results

  1. CRISPR Guide

    Type
    Collection
    ...combination of wild type alleles, NHEJ-repaired alleles, and the desired HDR-edited allele. Therefore, it is...presence of the desired edit experimentally and to isolate clones containing the desired edit (see: Validate...) and the desired edits on a RT template. The PBS base pairs to the 3’ flap, and the desired edit is incorporated...transcription-activator-like effector nucleases (TALENs) required scientists to design and generate a new nuclease...the Cas enzyme. Basic Mechanisms of CRISPR The requirements for a CRISPR knockout assay are simple. You’...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...of the PAM sequence. The resulting DSB is then repaired by one of two general repair pathways: the efficient...

  2. Plan Your Experiment

    Type
    Collection
    ...BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...percentage of DNA breaks will be repaired by NHEJ instead of incorporating your desired edit through HDR. Base ...methods and often require screening a larger pool of cells to find one with your desired edit. Lastly, you...base edits Can be paired with restriction enzymes for further customization Usually paired with a sequencing...must be experimentally verified Cut Nick Homology Directed Repair (HDR) Generate specific genomic edits, ...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...Activate Design and Clone Your gRNA Achieving your desired edit comes down to location, location, location...

  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...and study of stem cells, from iPSC generation to directed differentiation....the body and have the capacity to give rise to an entire organism. iPSC technology removes the possible ...below. Once iPSCs have been created they can be directly differentiated into specific somatic stem cells...Plasmids below. Alternatively, it is also possible to directly differentiate one differentiated somatic cell ...endogenously-tagged gene variants or browse Addgene’s entire collection of Stem Cell Research Plasmids . For...lentiviral plasmids A drug-inducible system for direct reprogramming of human somatic cells to pluripotency...Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic ...

  4. Antibody Guide

    Type
    Collection
    ...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ...

  5. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...

  6. Brain Armamentarium

    Type
    Collection
    ...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru...

  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  8. Genetic Code Expansion

    Type
    Collection
    ... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to...

  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand...

  10. Validated gRNA Sequences

    Type
    Collection
    ...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut...

  11. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  12. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...be separated by an internal ribosome entry site (IRES) and expressed under the same promoter. Alternatively...cells - one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA...response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid), 2) the HIV-1 genome...in terms of RCL generation because this vector requires only three HIV-1 genes (gag, pol, and rev) for...that there is often  background activity and it requires continuous administration of Dox to repress transgene...One drawback of the Tet system is that it often requires the delivery of two distinct expression vectors...This supernatant can be stored at 4 °C or can be directly added to your target cells. However in that case...

  13. CRISPR Plasmids - Plants

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

  14. CRISPR Plasmids - Yeast

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Description Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding known transcription...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

  15. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Nat Commun... with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with peroxiredoxin-based...cellular locations. PLoS One. 2012;7(11):e49371. Direct comparison of a genetically encoded sensor and ...11/520/eaah3738. Justin Blau cAMP (cyclic AMP) cAMPFIRE cAMP biosensors with improved sensitivity Sensitive... PLoS One. 2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron...mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors...mammalian expression (Constitutive or Cre-dependent) Directed Evolution of a Selective and Sensitive Serotonin...

  16. Worm Expression Resources

    Type
    Collection
    ...Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C....characterized which allow researchers to express desired constructs in precise cell types and/or developmental...plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert ...modified approach has also been developed by the Fire laboratory and described in Efficient Marker-Free...vectors. C. elegans optimized fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes...

  17. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...off-target alterations and require only a single gRNA. Cas3 must be paired with the Cascade ( C RISPR-...can continue for many kilobases in one or both directions from the target region, effectively turning Cas3... Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade is directed to target DNA using a gRNA and recruits Cas3. ...other proteins bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3...

  18. Viral Vector Guides and Plasmids

    Type
    Collection
    ...cultures, these plasmids direct the production of viral vectors that contain the desired genetic cargo. In turn...their mild immunogencity. These viral vectors can direct long-term transgene expression, but generally don't..., such as different promoters or tags, can even direct delivery of the genetic cargo to specific cell ...prevent uncontrolled viral replication, and the required genes are divided in the multi-plasmid system....

  19. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mT-sapphire 399 511 Monomer (A206K) mT-Sapphire-N1 - Mammalian Expression mT-Sapphire-C1 - Mammalian...Structure Plasmids T-sapphire 399 511 26 4.9 1.3 hr Prone to dimerization pFA6a-link-yETSapphire-CaUra3 - Yeast...Mammalian Expression mT-Sapphire-pBAD - Bacterial Expression mAmetrine 406 526 26 6 0.8 hr Monomer (A206K...

  20. Rett Syndrome

    Type
    Collection
    ..., is regression of previously acquired skills, notably loss of acquired purposeful hand movements and ...Envigo. The following cell lines are available directly from the labs in which they were created. Find...rsrt.org The following cell lines are available directly from the labs in which they were created. Find... a p.R168X or p.T158M MECP2 mutation, and the direction and degree of skewing of X-chromosome inactivation...

  21. DNA Service - Cloning Grade DNA

    Type
    Collection
    ...removing the amplification and extraction steps required when one receives plasmids in bacterial stabs....yield slightly different DNA concentrations. Can I directly transfect cloning grade DNA into cells? Cloning...DNA is designed for use in cloning applications. Direct transfection into cells is not recommended. Can...independently including the check out and will require separate shipping charges. Where can I find cloning...

  22. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

  23. Serotype Testing AAV

    Type
    Collection
    ...for direct injection. These AAV are made from plasmid 50465 (deposited by Bryan Roth ) and direct EGFP...Ready-to-use AAV in various serotypes suitable for direct injection. These AAV are made from plasmid 37825...37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information about...

  24. Bacterial Expression Systems

    Type
    Collection
    ...Michael Davidson 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET...peptides are used to enhance protein solubility and to direct recombinant proteins to the periplasmic space between...expression from that element. When this activation requires a transcription factor to bind to a small molecule...pMV306hsp+FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson ,...

  25. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...following in mind: CRISPR screening experiments require electroporation to amplify the pooled library and...library representation. CRISPR screening experiments require large quantities of cells and therefore, may not...limited (e.g. primary cells). Most CRISPR libraries require the use of lentivirus to deliver the gRNA/Cas9 ...of gRNAs - A given CRISPR library may target the entire genome or a specific class of genes (subpools)....Library 112200 Knockout Human Lin 3rd 4-5 8,382 Human Paired-guide RNA (pgRNA) Library for Long Non-coding RNAs...

  26. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...(PBS) and the desired edits on an RT template. During prime editing, the pegRNA directs the Cas9 nickase...that binds to a specific genomic DNA locus and directs the nickase to the target site. The longer pegRNA...3’ flap binds to the PBS of the pegRNA and the desired edit is incorporated into the DNA by reverse transcription...

  27. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...interest and effort directed toward expanding this capacity. Traditionally, AAV requires the presence of ... products that mediate AAV replication. This requirement has been circumvented with “helper-virus free...(which may not be available at Addgene) may be required to produce infectious AAV particles. You can search...

  28. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...DreO-bGHpA (50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral...Testing AAV inventory for the entire collection! We are expanding our entire control AAV inventory to give...promoter directs ubiquitous expression. pAAV-mDlx-NLS-mRuby2 (99130-AAVrg): The Dlx element directs expression...in the last few months. You can also browse our entire AAV inventory. Our new AAVs include: EGFP-expressing...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-...112677-AAV5 and 112677-AAVrg): The EF1a promoter directs strong, ubiquitous expression. This is a Cre-dependent...

  29. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...cell may instead repair the break using homology-directed repair (HDR). HDR is much less error-prone than...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

  30. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

  31. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ... and TniQ). Some type I CASTs can result in bidirectional insertions — meaning they may not be suitable...However, type I-F CASTs favor insertion in the T-RL direction, with the right homology end closest to the target... I, type V-K CASTs appear to exhibit almost unidirectional insertions, but are more prone to off-target...

  32. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...material. The mitochondria produces the energy cells required for chemical reactions. Labeling these structures...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin ... the proteins that enter the secretory pathway require chaperones to help with folding or post-translational...

  33. Addgene Packaged on Request: Scope of Service

    Type
    Collection
    ...charges may be required before your order will be delivered. The courier will contact you directly regarding...additional customs documentation that might be required by your country for the import of biological research...

  34. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ...vectors if you need to. Additionally, they have an IRES-Puro marker to facilitate stable cell clone selection... of dollars, but by approaching it from a new direction, we hope to do it much faster. Years of science...

  35. Lentiviral Prep Service

    Type
    Collection
    ...library expresses EGFP for easy visualization via direct fluorescence. Morris 115644 Morris CellTag Barcode...library expresses EGFP for easy visualization via direct fluorescence. Morris 115645 Morris CellTag Barcode...library expresses EGFP for easy visualization via direct fluorescence. Morris Control Lentivirus Browse ...

  36. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...(loxP) are on the same DNA strand in opposite directions, recombination results in an inversion and the...are on the same DNA strand (in cis) in the same direction, the sequence between the sites is excised as ...evaluating infection/transfection efficiency, selecting desired clones, and making transgenic mice. ID Plasmid ...

  38. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). Want more information on the wide...

  39. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...provides a stark contrast to Cas9 and Cpf1, which require that each DNA target have high sequence identity...to limit the spread of infection throughout the entire population. Type VI enzymes that function in mammalian...

  40. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...
Showing: 41 - 80 of 919 results