Skip to main content
Addgene

We narrowed to 1,076 results for: TOR;

Showing: 931 - 960 of 1076 results
  1. Cre-lox system

    Type
    Collection
    ...Cre-ERT2 - Tamoxifen inducible; Gateway entry vector none Entry Vector Zon 27493 pBT140 Cre CMV Mammalian Luo...Cre-ERT2;Targeting vector for Fos locus Mammalian Luo 46389 pArcCreER Cre-ERT2;Targeting vector for Arc locus...Burgess 61570 Pvalb-2A-Cre targeting vector Cre; Targeting vector for Pvalb locus Mammalian Zeng 61573...61573 Rasgrf2-2A-dCre targeting vector DHFR-destabilized Cre; targeting vector for Rasgrf2 Mammalian Zeng ...Zeng 61574 Slc17a7-IRES2-Cre targeting vector Cre; Targeting vector for Slc17a7 locus Mammalian Zeng 62219...Nxph4-2A-CreERT2 Targeting Vector Cre-ERT2 - Tamoxifen inducible; Targeting vector Mouse Nxph4 Mammalian Zeng...pRRlsinPGK_CREGFP_WPRE Cre-GFP fusion PGK Lentiviral Torok-Storb 99249 pVAX1/mTyr-Cre Cre Tyrosinase Mammalian...
  2. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...full sequencing of the final viral vector preparation. These viral vector preparations were produced with...Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model...of Primary Human Hematopoietic Stem/Progenitor Cells by AAV6 Vectors: Strategies for Overcoming Donor-Variation...quality AAV preps from select plasmids in the repository. Browse the University of Florida serotype testing... Viral Vector Packaging Service AAV University of Florida Serotype...Serotype Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype ...
  3. Viral Production

    Type
    Collection
    ... with viral vector manufacturing facilities, such as the University of Pennsylvania Vector Core (Link ...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Empty vector particles can be identified after negative staining and appear darker than full vector particles...Electron micrograph of AAV vector preparation shows that the vast majority of the vectors consist of full particles... Viral Vector Packaging Service Viral Production Viral Production...vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by...to determine which facility produced your viral vector lot. At Addgene, AAV particles are titered by droplet...
  4. Chemogenetics Plasmids

    Type
    Collection
    ...cells expressing these engineered receptors. Chemogenetic receptors are popular in neuroscience, where...pathway the engineered receptor is coupled to and the specific cell type where the receptor is expressed, these...contains two main classes of chemogenetic receptors: Designer Receptors Exclusively Activated by Designer Drugs...Selective Actuator Modules (PSAMs). DREADDs are the most widely used chemogenetic receptors and are G-...Gi) and KORD are inhibitory. PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains ...chemogenetic resources available at Addgene. See our inventory of chemogenetic constructs, including DREADD constructs...Service: Chemogenetics AAV Blog: Chemogenetics Viral Vectors 101 Blog: Chemogenetics vs. Optogenetics Chemogenetics...
  5. Zhang Lab CRISPR Page

    Type
    Collection
    ... in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9...Expresses dCAS9-VP64 activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with...lentiviral vector encoding dCAS9-VP64 with 2A Blast resistance marker 61426 : lentiviral vector encoding...Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, ...61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors for cancer modeling...SpCas9 or SpCas9n, and the single guide RNA. The vector can be digested using BbsI, and a pair of annealed...indicated below) can be cloned scarlessly into the vector before the sgRNA scaffold. The oligos are designed...
  6. Viral Prep Service for Plasmids and Pooled Libraries

    Type
    Collection
    ...technologies. Penn Vector Core AAV Vectors Many AAV vectors from the Penn Vector Core have been transferred to Addgene... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...and we’ll make the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information...about viral vector production at Addgene, ordering information, and more. Additional Viral Vector Resources...when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation...biosafety of viral vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from...aspects of viral vectors, including troubleshooting advice and explanations of viral vector technologies....
  7. TALEN Guide

    Type
    Collection
    ...never happen. Yet with transcription activator-like (TAL) effectors, scientists in several biological disciplines... and help can be found at TALeffector Resources Center (www.taleffectors.com) . Whether you work in a ...between two distinct ZF target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ...published the nucleotide recognition code of the TAL effectors, which were isolated from the plant bacterial ...that determines which single nucleotide the TAL effector will recognize: ( Figure 1B ) HD targets cytosine... in your average genome are every 500 bp. TAL effectors have some restrictions (for example, the target...determining the importance of context for each TAL effector within an array, but early studies suggest the...
  8. p53 Pathway

    Type
    Collection
    ... Tumor necrosis factor receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell ... PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP...p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor 1A p48 Damage-specific DNA...plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor activated by cellular stress...Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...List References Background p53 is a transcription factor and tumor suppressor activated by cellular stresses..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity...
  9. Validated gRNA Sequences

    Type
    Collection
    ...EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria GAAGTTCGAGGGCGACACCC... EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT... EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC...EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG... EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria GGGCGAGGAGCTGTTCACCG... EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA... GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA...
  10. Neurodegeneration Research Collection

    Type
    Collection
    ...upper and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to...AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell ...tet-inducible expression of transcription factors for sensory, motor, and cortical neuron differentiation....CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies Fluorescent Proteins Other Resources...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases...portion of cases can be attributed to known genetic factors such as defects in LRRK2, SNCA, PARK7, or PINK1... gene variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE...
  11. Plant Plasmids and Resources

    Type
    Collection
    ...assembling plant transformation vectors - Daniel Voytas. Transcription Factors The following collections can...plants: Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant...microRNA and siRNA vectors in Arabidopsis - James Carrington. JoinTRV , an improved vector system based on...Blog: Plant Biology CRISPR Cloning Transcription Factors RNAi Empty Backbones Fluorescent Proteins Other...Other Resources Background Addgene’s repository contains many plasmid tools that were specifically designed...plant species (e.g. maize and Arabidopsis) and vectors for easy assembly of one or more gRNA expression...for Plants includes CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters for expression in...
  12. Luciferase Plasmid Collection

    Type
    Collection
    ...mutations of these regulatory elements on gene expression. Empty backbones for inserting regulatory elements before... reporter vector via Gateway cloning to test for the presence of transcriptional regulatory region in ...regions Joshua Mendell 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription...are commonly used to investigate the effect of regulatory elements, such as promoters, enhancers and untranslated...strong constitutive promoter and can be used to monitor transfection or viral infection efficiency, to ...luciferase to assess FKBP and FRP interactions in the mTOR signaling pathway in vivo . DULIP ( DU al L uminescence-based...Optimized STARR-seq ( S elf- T ranscribing A ctive R egulatory R egion) plasmids : Genome-wide screening of enhancer...
  13. Rett Syndrome

    Type
    Collection
    ...Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor (NCoR/...Cell Line Repositories (Link opens in a new window) Coriell Institute - cell line repository, including...in a new window) MMRRC Repository - NIH-supported mouse and cell line repository (Link opens in a new window...largest biorepositories (Link opens in a new window) ATCC - the world's largest cell line repository Tissue... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene disruptions...
  14. AAV Packaged on Request

    Type
    Collection
    ...Resources Viral Vector Production Learn about how we produce high-quality viral vector preps at Addgene...Request service with all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification... Viral Vector Packaging Service Packaged on Request AAV Packaged...Additional Resources Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively... protection levels. We offer 963 in-stock viral vector preps, delivering high quality and ready availability...availability at affordable prices. While our repository serves the needs of many researchers, scientists sometimes... the steps to produce, purify, and titer viral vectors. Overview Our new Packaged on Request service is...
  15. Lentiviral Prep Service

    Type
    Collection
    ...more details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled...dCas9) can be fused to a transactivator and used as a transcriptional activator . ID Name Insert Antibiotic...Ready-to-use lentivirus available from Addgene's viral vector packaging service. Browse constructs currently ... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific...
  16. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting vector assembly, and the remaining 5 plasmids include Cre and FLP expression vectors, a general...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...Cas plasmid-system consists of two components: A vector containing Cas9 and a validated gRNA, based on ...tagging system were tested by tagging transcription factors with FLAG in human cell lines. To repeat the tagging...the isolation of native protein complexes. This vector serves as a backbone to clone the left and right...Alternatively, cDNAs can be cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus...gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_...
  17. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...Expression Vectors You can use the tables on Addgene's Empty gRNA Vectors page to search based on factors such...specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T ...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...editing window specified by the gRNA. Adenine base editors convert adenine to inosine, which is replaced by...Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...
  18. CRISPR References and Information

    Type
    Collection
    ... gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) ... dCas9 activators sgRNA dual expression: pAC2 , pAC152 , pAC153 , pAC154 ; pmax dCas9 activator expression... pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro...webtool that uses deep learning models for base editor gRNA design and efficiency prediction. Developed...webtool that uses deep learning models for prime editor pegRNA design and efficiency prediction. Developed... Lab and maintained by the Frederick National Laboratory at the National Cancer Institute. Cas-OFFinder...information from Cas-OFFinder and Microhomology predictor. Developed by the Jin-Soo Kim Lab . CRISPR-ERA...
  19. Synthetic Biology - Overview

    Type
    Collection
    ...and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more. Also... Lab Repressors , Terminators , Light Signaling , Sigma Factors , Resource Allocator and Orthogonal Switches...cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium Community Resources...including shuttle, integration, reporter, and tagging vectors. Metabolism Browse plasmids related to metabolic...Plasmids and Phagemids Balazsi Lab Negative Autoregulation and Yeast-Mammalian Circuit Transfer C. Collins...Plasmid Kit Gray Lab Maize and Rice Transcription Factors Hasty Lab Biopixels Jaramillo Lab Riboregulation...Foundation Registry of Standard Biological Parts - Repository of community-created BioBricks BioBricks Foundation...
  20. Plan Your Experiment

    Type
    Collection
    ... in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene (e.g. GFP...or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual) gRNA targeting the region where...reduced efficiency compared to NHEJ knockout. Base editors can make a limited set of mutations. Repress or...without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting promoter...promoter elements of target gene Many different activators exist, including the multi-plasmid SAM system. Select...Components of System Application Mammalian expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha...lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression of Cas9 and/or...
  21. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...to an acceptor. Since the transfer of energy does not occur by emission of a photon, the acceptor molecule...and measuring the emission of the acceptor. For a given donor-acceptor pair, the FRET efficiency strongly...constructed using the cpFRET kit from the Pertz laboratory. Empty Vectors Encoding Fluorescent Proteins for FRET...proteins have been developed for use as donor and acceptor pairs in FRET experiments. The efficiency of ... depends on the distance between the donor and acceptor molecules and can therefore be used to calculate...calculate the distances between the donor and acceptor. FRET is often used to study (1) protein-protein interactions...each protein is separately fused to a donor or acceptor molecule (also referred to as intermolecular or...
  22. TALEN Engineering

    Type
    Collection
    ...Expression Vectors for REAL, REAL-Fast and FLASH TALE Transcriptional Activator Expression Vectors for REAL...Reagents from the Keith Joung laboratory for engineering TAL effectors, including designed TALENs, and...TALEN Kits TALengineering Reagents Joung Lab TAL Effector Engineering Reagents You may also like... Keith... developed three platforms for engineering TAL effector repeat arrays of any desired length: the REAL ...2012). All three of these platforms assemble TAL effector repeat arrays on a single architectural framework...all three methods are identical in sequence. TAL effector repeat arrays produced on this framework has yielded..., Nat Biotechnol. 2011 ) TALE transcriptional activators in human cells ( Maeder et al., Nat Methods 2013...
  23. AAV Molecular Tools

    Type
    Collection
    ...Molecular Tools Viral Vector Packaging Service: Molecular Tools Tetracycline Transactivators Affinity Purification...encoding tet-off transactivators and tools for affinity purification (TRAP). Viral... Viral Vector Packaging Service...Neurophysiology Cell Ablation Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible...-inducible tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible...CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible... promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...
  24. Zebrafish Plasmid Collection

    Type
    Collection
    .... pGCS Vector Kit - Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination vectors (pGCS),...encode zebrafish receptors or monoclonal antibodies to zebrafish cell surface receptors and secreted proteins...found below: UFlip CRISPR targeted integration vectors for cell-type specific conditional gene inactivation...inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration Using CRISPR/Cas9 - Jeffrey Essner...mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish...zebrafish Whole organism lineage tracing by combinatorial and cumulative genome editing - Jay Shendure...with four promoters, six fluorophores, and empty vectors designed to streamline the production of transgenic...
  25. Antibody Guide

    Type
    Collection
    ...antibodies can be stored at 4 °C for short-term storage. For long-term storage they should be stored at -20 °C... Antibody Handling Storage Check the manufacturer’s instructions for exact storage requirements. As a ...tips for storing your antibody: Antibodies conjugated to fluorophores should never be stored below 4 °... antibodies should not be stored in sodium azide, as it acts as an inhibitor to HRP. In those cases, thimerosal...define key terms, summarize antibody production and storage techniques, and explain common applications. Science...expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell, and sample... a primary antibody, which becomes the limiting factor for the number of proteins you can detect in a ...
  26. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Two classes of base editors — cytosine base editors (CBEs) and adenine base editors (ABEs) — can be used...base editors, the evolved TadA domain is fused to a Cas9 protein to create the adenine base editor. Both...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ... without double stranded breaks. Cytosine base editors are created by fusing Cas9 nickase or catalytically...dCas9) to a cytidine deaminase like APOBEC. Base editors are targeted to a specific locus by a gRNA, and...on the opposite strand). Likewise, adenine base editors have been engineered to convert adenosine to inosine...Both types of base editors are available with multiple Cas9 variants including high fidelity Cas9’s. Further...
  27. CRISPR Plasmids - Yeast

    Type
    Collection
    ...cytosine base editor that can alter DNA bases without inducing a DNA break. Cytosine base editors convert C...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors such as selectable marker...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...editing window specified by the gRNA. Adenine base editors convert adenine to inosine, which is replaced by...Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...
  28. Microbiology Resources

    Type
    Collection
    ...a bacterial stab (of a laboratory E. coli strain). Addgene continues to monitor its library and distributions...Broad-Range Rainbow Vectors - Barbier Lab Cloning and Expression Bacteria and yeast expression vectors : FX cloning...Microbiology Plasmids and Resources Addgene’s repository contains plasmid tools for a range of microbial...plasmid tools for the community that aren't in the repository? Help us widen our resources for the community...protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP plasmid kit : Integration...Yarrowia lipolytica Golden Gate tool kit : Integrative vector assembly of up to three transcription units in ...lipolytica - Rossignol Lab Yeast Gateway kit : 285 vectors for expression, markers, fusion proteins, etc -...
  29. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...cytosine base editor that can alter DNA bases without inducing a DNA break. Cytosine base editors convert C...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors such as selectable marker...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...editing window specified by the gRNA. Adenine base editors convert adenine to inosine, which is replaced by...Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...
  30. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Publication Empty Prime Editing gRNA Vectors A selection of empty gRNA vectors suitable for prime editing are...tevopreq1-GG-acceptor Mammalian hU6 epegRNA BsaI No mRFP1 David Liu 174039 pU6-tmpknot-GG-acceptor Mammalian...Find prime editor plasmids for (search and replace) genome editing. CRISPR...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...enzyme is named PE1 . PE1 and most other prime editors use the Moloney murine leukemia virus (M-MLV) reverse...can be used in PE2–PE5 systems PE6 - small prime editors with optimized RT and/or Cas9 domains PE7 - addition...addition of RNA-binding exonuclease protection factor La to PEmax to enhance pegRNA stability epegRNA -...
Showing: 931 - 960 of 1076 results